Incidental Mutation 'R6044:Crispld2'
ID483718
Institutional Source Beutler Lab
Gene Symbol Crispld2
Ensembl Gene ENSMUSG00000031825
Gene Namecysteine-rich secretory protein LCCL domain containing 2
Synonyms1810049K24Rik, Lgl1, coffeecrisp
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.375) question?
Stock #R6044 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location119992438-120052793 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120010671 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 54 (S54P)
Ref Sequence ENSEMBL: ENSMUSP00000122962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034282] [ENSMUST00000108972] [ENSMUST00000127664] [ENSMUST00000132583]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034282
AA Change: S54P

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000034282
Gene: ENSMUSG00000031825
AA Change: S54P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCP 54 208 1.2e-48 SMART
LCCL 284 368 1.25e-45 SMART
LCCL 385 477 1.28e-51 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108972
AA Change: S54P

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104600
Gene: ENSMUSG00000031825
AA Change: S54P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCP 54 208 1.2e-48 SMART
LCCL 283 367 1.25e-45 SMART
LCCL 384 476 1.28e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000132583
AA Change: S54P

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122962
Gene: ENSMUSG00000031825
AA Change: S54P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCP 54 208 1.2e-48 SMART
LCCL 283 367 1.25e-45 SMART
LCCL 384 476 1.28e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151629
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice show various immunological abnormalities, enhanced glucose tolerance and decreased bone-related measurements. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G A 14: 32,660,657 S1117L possibly damaging Het
Adamts20 A T 15: 94,282,483 Y1764N probably damaging Het
Adamtsl1 A T 4: 86,212,691 D223V probably damaging Het
Agbl1 T C 7: 76,318,120 V31A possibly damaging Het
Alk T C 17: 71,992,100 H462R probably benign Het
Amt A T 9: 108,297,251 T72S probably damaging Het
Atp12a T A 14: 56,376,155 D461E probably damaging Het
Bcan C A 3: 87,995,643 C276F probably damaging Het
Cyp11a1 A T 9: 58,026,704 N478I probably damaging Het
Des A T 1: 75,363,469 probably null Het
Dnajc6 A T 4: 101,616,577 I427F probably benign Het
Eml4 T G 17: 83,445,950 L281R probably damaging Het
Fam186a T C 15: 99,941,997 Y2122C probably damaging Het
Fndc11 T A 2: 181,221,666 L88Q probably damaging Het
Foxo1 A G 3: 52,345,837 M474V probably benign Het
Gap43 A T 16: 42,292,187 D70E probably benign Het
Gemin4 T C 11: 76,212,934 M334V probably benign Het
Gm973 T C 1: 59,628,234 L718P probably benign Het
Gprin3 G T 6: 59,353,672 T550N possibly damaging Het
Hddc3 T A 7: 80,343,584 V53E probably benign Het
Itpr2 A T 6: 146,396,951 D12E probably null Het
Kdelc1 A T 1: 44,114,451 L221* probably null Het
Klri2 T A 6: 129,740,284 E45D probably damaging Het
Lct A G 1: 128,307,980 V430A possibly damaging Het
Mcm8 T C 2: 132,831,680 probably null Het
Mmp12 A G 9: 7,350,050 T184A possibly damaging Het
Morc3 T C 16: 93,866,442 V511A probably benign Het
Mta2 T C 19: 8,948,331 Y397H probably damaging Het
Naa50 G A 16: 44,159,527 E93K possibly damaging Het
Olfr113 G A 17: 37,574,535 T296M probably damaging Het
Olfr1250 T A 2: 89,657,172 I90F probably damaging Het
Olfr1261 T C 2: 89,993,417 I8T possibly damaging Het
Olfr1286 T C 2: 111,420,078 N291S probably damaging Het
Olfr1395 T C 11: 49,148,695 V146A probably benign Het
Padi4 A G 4: 140,748,127 S576P possibly damaging Het
Prss47 A T 13: 65,049,306 Y111* probably null Het
Ptprm A G 17: 66,693,862 V1100A probably damaging Het
Rab11fip3 G A 17: 26,067,869 P437S possibly damaging Het
Rsph14 C T 10: 75,031,270 D15N probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slco1a1 A G 6: 141,940,017 V94A probably benign Het
Smpdl3a A G 10: 57,811,262 E362G possibly damaging Het
Sva A T 6: 42,040,100 Y47F probably benign Het
Tatdn3 A G 1: 191,056,361 probably null Het
Tmem131 G A 1: 36,881,341 Q93* probably null Het
Tmem136 A G 9: 43,113,608 S18P probably benign Het
Tmem56 A T 3: 121,207,369 I205K probably damaging Het
Trpm7 T C 2: 126,814,745 E1184G probably damaging Het
Ubr1 T C 2: 120,862,721 I1735V probably benign Het
Usp40 A T 1: 87,990,150 I325K probably benign Het
Vmn2r27 T G 6: 124,231,772 I5L probably benign Het
Wee1 C T 7: 110,139,306 T542I probably benign Het
Wrn G A 8: 33,236,429 P1129S probably damaging Het
Zfyve16 G A 13: 92,522,666 Q246* probably null Het
Other mutations in Crispld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Crispld2 APN 8 120033560 missense probably damaging 1.00
IGL00835:Crispld2 APN 8 120010648 missense probably damaging 1.00
IGL03209:Crispld2 APN 8 120031098 missense possibly damaging 0.88
IGL03324:Crispld2 APN 8 120015371 missense probably damaging 1.00
R0172:Crispld2 UTSW 8 120026071 missense possibly damaging 0.80
R0212:Crispld2 UTSW 8 120010631 missense probably benign
R0492:Crispld2 UTSW 8 120026067 missense probably benign 0.30
R1532:Crispld2 UTSW 8 120023572 missense probably benign
R1715:Crispld2 UTSW 8 120023649 missense possibly damaging 0.75
R1865:Crispld2 UTSW 8 120010567 missense probably benign 0.00
R1953:Crispld2 UTSW 8 120015296 missense probably damaging 1.00
R2161:Crispld2 UTSW 8 120015339 missense probably damaging 1.00
R2306:Crispld2 UTSW 8 120026071 missense probably damaging 0.99
R2851:Crispld2 UTSW 8 120014089 missense probably damaging 1.00
R3774:Crispld2 UTSW 8 120029266 missense probably damaging 0.99
R3776:Crispld2 UTSW 8 120029266 missense probably damaging 0.99
R6485:Crispld2 UTSW 8 120029309 missense probably damaging 0.99
R6861:Crispld2 UTSW 8 120026113 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCTTAGTTGTGGCTGAAGGC -3'
(R):5'- CTCAGTTAGAAGAGAGCCTGTAGC -3'

Sequencing Primer
(F):5'- TGGCTGAAGGCGTGAAGC -3'
(R):5'- GGTCACTTCGAAGTTGAGTCAACC -3'
Posted On2017-07-14