Incidental Mutation 'R6062:Usp9y'
ID483880
Institutional Source Beutler Lab
Gene Symbol Usp9y
Ensembl Gene ENSMUSG00000069044
Gene Nameubiquitin specific peptidase 9, Y chromosome
SynonymsDffry, Fafl2
MMRRC Submission 044227-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6062 (G1)
Quality Score221.999
Status Validated
ChromosomeY
Chromosomal Location1298961-1459782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 1454199 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 23 (Q23K)
Ref Sequence ENSEMBL: ENSMUSP00000088727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091188]
Predicted Effect probably benign
Transcript: ENSMUST00000091188
AA Change: Q23K

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000088727
Gene: ENSMUSG00000069044
AA Change: Q23K

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
low complexity region 286 301 N/A INTRINSIC
low complexity region 973 983 N/A INTRINSIC
low complexity region 1089 1100 N/A INTRINSIC
low complexity region 1352 1363 N/A INTRINSIC
Pfam:UCH 1558 1955 9.2e-53 PFAM
Pfam:UCH_1 1559 1909 4e-22 PFAM
low complexity region 1959 1971 N/A INTRINSIC
Meta Mutation Damage Score 0.1112 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the peptidase C19 family. It encodes a protein that is similar to ubiquitin-specific proteases, which cleave the ubiquitin moiety from ubiquitin-fused precursors and ubiquitinylated proteins. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 G T 4: 58,826,453 S1038Y possibly damaging Het
Atat1 T A 17: 35,908,564 Q136L probably damaging Het
Atm A G 9: 53,488,587 L1531P probably damaging Het
Brca2 G A 5: 150,556,889 R2708H probably damaging Het
Cand1 G A 10: 119,218,010 A141V possibly damaging Het
Cdcp2 T C 4: 107,102,492 S35P probably damaging Het
Ces4a G A 8: 105,138,174 probably null Het
Colec10 T A 15: 54,459,807 M142K possibly damaging Het
Crtc1 G T 8: 70,406,189 D90E probably damaging Het
Csmd1 T C 8: 16,092,305 E1528G possibly damaging Het
Csnk2a2 A G 8: 95,457,469 V154A possibly damaging Het
Daglb T C 5: 143,494,603 I454T probably benign Het
Dtna C A 18: 23,622,056 N478K possibly damaging Het
E330034G19Rik A T 14: 24,293,380 probably benign Het
Eefsec A T 6: 88,355,629 S200T probably benign Het
Enthd1 T A 15: 80,452,715 D506V probably damaging Het
Erbb2 A G 11: 98,433,249 Y736C probably damaging Het
Gabrg1 A G 5: 70,780,713 C183R probably damaging Het
Ginm1 T A 10: 7,775,333 H103L probably benign Het
Golgb1 C A 16: 36,914,671 Q1427K possibly damaging Het
Grb14 G T 2: 65,022,620 Q9K possibly damaging Het
Hbp1 A T 12: 31,937,247 M192K probably damaging Het
Herpud2 A T 9: 25,108,988 D357E probably damaging Het
Idi1 A G 13: 8,887,505 S111G probably damaging Het
Lrrc32 T C 7: 98,498,541 V176A probably benign Het
Matn1 T A 4: 130,951,966 D310E probably benign Het
Mbtps1 A T 8: 119,531,091 L469Q possibly damaging Het
Muc4 A G 16: 32,759,308 D2417G unknown Het
Myo7b T C 18: 31,967,990 T1551A possibly damaging Het
Neb A G 2: 52,185,281 M224T probably benign Het
Ola1 A T 2: 73,199,498 D92E probably damaging Het
Olfr1019 T G 2: 85,841,114 I226L probably benign Het
Olfr388-ps1 A C 11: 73,724,560 C155G unknown Het
Olfr723 A T 14: 49,928,662 M294K probably damaging Het
Olfr912 T A 9: 38,539,144 M83K probably damaging Het
Otud4 T C 8: 79,673,896 Y1080H probably damaging Het
Plce1 G A 19: 38,524,751 A165T probably benign Het
Prelid2 T C 18: 41,912,465 I127V probably benign Het
Rab35 A G 5: 115,640,088 I38V probably damaging Het
Rab3d T C 9: 21,910,519 T209A probably benign Het
Rapgef1 A G 2: 29,700,732 E321G probably damaging Het
Rem1 T C 2: 152,628,097 M1T probably null Het
Rgsl1 T C 1: 153,799,872 K181R possibly damaging Het
Scel C A 14: 103,585,136 N395K possibly damaging Het
Sept9 A G 11: 117,290,800 E142G possibly damaging Het
Shcbp1 A C 8: 4,764,905 M191R probably benign Het
Slc22a19 T C 19: 7,674,282 N520S probably damaging Het
Slc28a1 C T 7: 81,115,563 R9* probably null Het
Slc2a7 T C 4: 150,168,427 V508A probably benign Het
Slc8a3 G A 12: 81,314,350 P565L probably damaging Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Tenm3 T G 8: 48,343,406 I455L possibly damaging Het
Tmem267 T C 13: 119,609,231 S141P probably damaging Het
Tnn T A 1: 160,098,278 D1383V probably damaging Het
Vmn1r46 T C 6: 89,976,259 I30T possibly damaging Het
Zfp382 T C 7: 30,133,590 L222P probably damaging Het
Zfp950 T A 19: 61,120,425 K73N possibly damaging Het
Other mutations in Usp9y
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4466001:Usp9y UTSW Y 1432197 missense probably damaging 0.96
R0288:Usp9y UTSW Y 1333606 splice site probably benign
R0365:Usp9y UTSW Y 1364732 missense probably damaging 1.00
R0386:Usp9y UTSW Y 1316933 missense probably damaging 1.00
R0395:Usp9y UTSW Y 1340053 missense probably damaging 1.00
R0518:Usp9y UTSW Y 1307880 missense probably benign
R0521:Usp9y UTSW Y 1307880 missense probably benign
R0530:Usp9y UTSW Y 1333600 splice site probably benign
R0759:Usp9y UTSW Y 1299097 missense probably damaging 0.99
R0849:Usp9y UTSW Y 1394002 missense probably damaging 1.00
R0932:Usp9y UTSW Y 1315930 missense probably benign 0.37
R1018:Usp9y UTSW Y 1341414 splice site probably benign
R1208:Usp9y UTSW Y 1356282 missense probably benign
R1208:Usp9y UTSW Y 1356282 missense probably benign
R1470:Usp9y UTSW Y 1332471 missense probably benign 0.19
R1470:Usp9y UTSW Y 1332471 missense probably benign 0.19
R1730:Usp9y UTSW Y 1367093 missense probably benign 0.18
R1743:Usp9y UTSW Y 1316727 missense probably damaging 1.00
R1765:Usp9y UTSW Y 1384454 missense possibly damaging 0.88
R1775:Usp9y UTSW Y 1368089 missense probably damaging 1.00
R1783:Usp9y UTSW Y 1367093 missense probably benign 0.18
R1889:Usp9y UTSW Y 1448829 intron probably null
R1901:Usp9y UTSW Y 1303371 critical splice donor site probably null
R2081:Usp9y UTSW Y 1381277 missense possibly damaging 0.65
R2119:Usp9y UTSW Y 1303451 missense probably benign 0.00
R2357:Usp9y UTSW Y 1394050 missense possibly damaging 0.87
R2873:Usp9y UTSW Y 1310502 splice site probably benign
R3938:Usp9y UTSW Y 1313741 missense probably damaging 0.97
R4323:Usp9y UTSW Y 1434407 missense possibly damaging 0.93
R4385:Usp9y UTSW Y 1304756 missense probably damaging 1.00
R4407:Usp9y UTSW Y 1336375 missense probably benign 0.16
R4457:Usp9y UTSW Y 1394078 missense possibly damaging 0.62
R4747:Usp9y UTSW Y 1391284 missense possibly damaging 0.64
R4823:Usp9y UTSW Y 1444559 missense probably damaging 0.99
R4834:Usp9y UTSW Y 1317002 missense probably benign 0.32
R4872:Usp9y UTSW Y 1307920 missense probably damaging 1.00
R4911:Usp9y UTSW Y 1308041 missense probably damaging 0.96
R4915:Usp9y UTSW Y 1316735 missense probably damaging 0.99
R4962:Usp9y UTSW Y 1384336 missense probably damaging 1.00
R5378:Usp9y UTSW Y 1315928 missense probably damaging 0.99
R5422:Usp9y UTSW Y 1314676 missense probably benign
R5432:Usp9y UTSW Y 1368022 splice site probably null
R5442:Usp9y UTSW Y 1336467 missense possibly damaging 0.80
R5469:Usp9y UTSW Y 1364714 missense probably benign 0.01
R5500:Usp9y UTSW Y 1341875 missense probably damaging 1.00
R5729:Usp9y UTSW Y 1381339 missense probably damaging 0.97
R5891:Usp9y UTSW Y 1341535 missense probably benign 0.05
R5920:Usp9y UTSW Y 1316730 missense probably damaging 1.00
R5948:Usp9y UTSW Y 1324996 missense possibly damaging 0.79
R6265:Usp9y UTSW Y 1446843 missense probably benign 0.00
R6274:Usp9y UTSW Y 1316735 missense probably damaging 0.99
R6313:Usp9y UTSW Y 1385355 missense probably benign
R6330:Usp9y UTSW Y 1340123 missense probably benign 0.20
R6471:Usp9y UTSW Y 1384511 missense probably damaging 1.00
R6547:Usp9y UTSW Y 1444612 missense probably damaging 0.99
R6791:Usp9y UTSW Y 1325042 splice site probably null
R7194:Usp9y UTSW Y 1304672 missense probably damaging 1.00
R7357:Usp9y UTSW Y 1333656 missense possibly damaging 0.58
R7374:Usp9y UTSW Y 1381305 missense probably benign 0.00
R7404:Usp9y UTSW Y 1341780 missense probably benign 0.35
R7481:Usp9y UTSW Y 1432180 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTTTGCCTTCAGAGTCACAATTACC -3'
(R):5'- TAGGGCCTGGCATATGGTAATAC -3'

Sequencing Primer
(F):5'- GCCTTCAGAGTCACAATTACCTTTAG -3'
(R):5'- GTCTGCTCTTTGATCATGAC -3'
Posted On2017-07-14