Incidental Mutation 'R0519:Zp2'
ID48390
Institutional Source Beutler Lab
Gene Symbol Zp2
Ensembl Gene ENSMUSG00000030911
Gene Namezona pellucida glycoprotein 2
SynonymsZp-2
MMRRC Submission 038712-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R0519 (G1)
Quality Score187
Status Validated
Chromosome7
Chromosomal Location120126772-120145291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120138149 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 272 (I272T)
Ref Sequence ENSEMBL: ENSMUSP00000146926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033207] [ENSMUST00000207726] [ENSMUST00000208874]
Predicted Effect probably damaging
Transcript: ENSMUST00000033207
AA Change: I272T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033207
Gene: ENSMUSG00000030911
AA Change: I272T

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
ZP 364 630 1.06e-86 SMART
low complexity region 655 668 N/A INTRINSIC
transmembrane domain 684 703 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207333
Predicted Effect probably damaging
Transcript: ENSMUST00000207726
AA Change: I272T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208122
Predicted Effect probably damaging
Transcript: ENSMUST00000208874
AA Change: I272T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.364 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: This gene encodes a member of the zona pellucida family of glycoproteins that play an important role in the survival of growing oocytes, successful fertilization and the passage of early embryos through the oviduct. The encoded preproprotein undergoes proteolytic processing to generate the mature polypeptide that is incorporated into the extracellular matrix surrounding mouse oocytes. Mice lacking the encoded protein develop defective zonae pellucidae that disrupt folliculogenesis, fertility and development. [provided by RefSeq, Sep 2016]
PHENOTYPE: Female homozygous mutants exhibit a thin zona pellucida matrix in early ovarian follicles that becomes disassociated in pre-ovulatory follicles. Few oocytes are produced, and any that are fertilized fail to survive to the two-cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A G 5: 107,548,201 R168G probably benign Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2810004N23Rik C T 8: 124,839,929 G251R possibly damaging Het
3425401B19Rik A G 14: 32,662,962 S349P possibly damaging Het
Ackr4 A G 9: 104,099,451 V99A probably benign Het
Asxl3 A G 18: 22,523,520 Q1529R possibly damaging Het
Atg12 T C 18: 46,741,410 E46G probably benign Het
Cdcp2 A G 4: 107,107,192 probably benign Het
Clasrp A G 7: 19,584,164 probably benign Het
Clip2 A G 5: 134,516,151 V383A probably benign Het
Cntln C T 4: 85,005,053 probably benign Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Csmd2 A C 4: 128,487,005 Y2118S possibly damaging Het
Dip2c T A 13: 9,563,208 V415E probably damaging Het
Dpy19l2 C T 9: 24,558,095 R755Q probably benign Het
Dsn1 A T 2: 156,998,713 probably benign Het
Dtd2 T C 12: 52,004,959 probably benign Het
Dync1i1 A G 6: 6,027,399 T602A probably benign Het
Ercc6 A C 14: 32,526,842 D450A probably damaging Het
Fgf12 A T 16: 28,189,628 V104D probably benign Het
Frem1 A T 4: 82,970,633 probably null Het
Gcgr G T 11: 120,536,156 W88L probably damaging Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Hapln1 A G 13: 89,584,716 probably benign Het
Hmgn3 T C 9: 83,112,248 E40G probably damaging Het
Hsdl1 G A 8: 119,565,711 A255V probably damaging Het
Hyls1 T C 9: 35,561,203 K306E probably damaging Het
Jcad C T 18: 4,649,122 probably benign Het
Kif14 C A 1: 136,469,147 A397E probably damaging Het
Lcmt2 A T 2: 121,139,344 probably null Het
Lifr T C 15: 7,177,580 L524P probably damaging Het
Ly6g6f T C 17: 35,082,852 K209E possibly damaging Het
Macf1 G A 4: 123,471,320 T1651I probably benign Het
Mapk4 T C 18: 73,970,321 D39G probably damaging Het
Mbl1 A G 14: 41,158,565 M137V probably damaging Het
Mcm10 G A 2: 5,008,545 S92L probably benign Het
Mug1 A G 6: 121,851,424 K265R possibly damaging Het
Mxra7 A G 11: 116,810,786 probably null Het
Neu3 G A 7: 99,823,317 probably benign Het
Nsd1 A G 13: 55,312,835 T2395A probably benign Het
Olfr1034 A T 2: 86,047,067 Y195F probably benign Het
Olfr3 T A 2: 36,812,615 H159L probably damaging Het
Olfr750 T A 14: 51,071,157 I79F probably damaging Het
Olfr854 A T 9: 19,566,949 I145N probably benign Het
Osgepl1 T C 1: 53,321,096 V327A probably damaging Het
Pcdhb21 T C 18: 37,516,032 V738A possibly damaging Het
Plekha8 A T 6: 54,622,107 probably benign Het
Ptprq A C 10: 107,538,920 probably benign Het
Pus10 T A 11: 23,711,201 F263Y probably benign Het
Rad54b A T 4: 11,599,809 I338F probably damaging Het
Rad54l2 A G 9: 106,708,299 F756L probably damaging Het
Scn11a A G 9: 119,790,119 L719P probably damaging Het
Slc2a2 G A 3: 28,718,816 V253I possibly damaging Het
Slc39a4 A T 15: 76,615,138 N192K probably benign Het
Soat1 T A 1: 156,441,246 I245F probably damaging Het
Sorcs2 G A 5: 36,031,190 A858V probably benign Het
Tcim T C 8: 24,438,635 T88A possibly damaging Het
Tecta G A 9: 42,347,892 probably benign Het
Tgm5 C A 2: 121,048,895 L553F probably damaging Het
Tjp1 A G 7: 65,302,921 V1555A probably benign Het
Tmem214 A C 5: 30,869,668 M1L probably null Het
Togaram1 T C 12: 64,966,002 probably benign Het
Topaz1 C A 9: 122,749,479 L485I possibly damaging Het
Ttn T C 2: 76,718,282 probably benign Het
Ube2o A G 11: 116,546,459 probably null Het
Ubr7 T A 12: 102,768,206 D246E probably benign Het
Vcpkmt T C 12: 69,582,328 D132G probably benign Het
Vmn2r111 T A 17: 22,573,121 Q51H probably benign Het
Vmn2r95 C T 17: 18,439,503 P170S probably damaging Het
Zbtb38 A G 9: 96,685,773 I1086T probably damaging Het
Zfp444 G A 7: 6,188,173 A118T probably benign Het
Other mutations in Zp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Zp2 APN 7 120133400 missense probably benign 0.00
IGL00707:Zp2 APN 7 120133413 missense probably benign 0.03
IGL00916:Zp2 APN 7 120138174 missense probably damaging 1.00
IGL01554:Zp2 APN 7 120138325 missense possibly damaging 0.78
IGL01845:Zp2 APN 7 120138191 missense probably damaging 1.00
IGL02111:Zp2 APN 7 120132418 missense possibly damaging 0.75
IGL02145:Zp2 APN 7 120139851 critical splice acceptor site probably null
IGL02155:Zp2 APN 7 120144117 missense probably benign 0.00
IGL02178:Zp2 APN 7 120133750 missense possibly damaging 0.85
IGL02646:Zp2 APN 7 120135341 missense possibly damaging 0.92
IGL03220:Zp2 APN 7 120137227 missense possibly damaging 0.90
PIT4687001:Zp2 UTSW 7 120141879 missense probably benign 0.00
R0138:Zp2 UTSW 7 120137200 missense probably damaging 0.96
R0197:Zp2 UTSW 7 120143576 splice site probably benign
R0573:Zp2 UTSW 7 120135470 splice site probably benign
R0879:Zp2 UTSW 7 120135534 missense probably damaging 1.00
R0883:Zp2 UTSW 7 120143576 splice site probably benign
R1160:Zp2 UTSW 7 120136045 missense probably damaging 1.00
R1235:Zp2 UTSW 7 120138343 missense possibly damaging 0.57
R1753:Zp2 UTSW 7 120138105 missense probably benign
R1883:Zp2 UTSW 7 120133401 missense probably benign 0.02
R1995:Zp2 UTSW 7 120135165 missense probably damaging 0.97
R2196:Zp2 UTSW 7 120138306 missense probably benign
R2850:Zp2 UTSW 7 120138306 missense probably benign
R3715:Zp2 UTSW 7 120141834 missense possibly damaging 0.95
R3931:Zp2 UTSW 7 120132357 intron probably benign
R4082:Zp2 UTSW 7 120135252 missense probably benign 0.01
R4731:Zp2 UTSW 7 120138120 missense probably damaging 0.96
R4732:Zp2 UTSW 7 120138120 missense probably damaging 0.96
R4733:Zp2 UTSW 7 120138120 missense probably damaging 0.96
R4754:Zp2 UTSW 7 120138318 missense probably benign 0.01
R4863:Zp2 UTSW 7 120135772 missense probably damaging 1.00
R5274:Zp2 UTSW 7 120138092 missense possibly damaging 0.92
R5392:Zp2 UTSW 7 120135764 nonsense probably null
R5877:Zp2 UTSW 7 120133339 missense probably null 0.94
R6390:Zp2 UTSW 7 120141230 missense probably benign 0.23
R6404:Zp2 UTSW 7 120135542 missense possibly damaging 0.73
R6546:Zp2 UTSW 7 120132525 missense probably benign 0.00
R6622:Zp2 UTSW 7 120132525 missense probably benign 0.00
R6622:Zp2 UTSW 7 120141913 missense probably benign
R6707:Zp2 UTSW 7 120133922 missense possibly damaging 0.85
R7274:Zp2 UTSW 7 120132391 makesense probably null
X0017:Zp2 UTSW 7 120133385 missense probably damaging 1.00
X0023:Zp2 UTSW 7 120133367 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATCCATCAAGACTAGCCTCAGG -3'
(R):5'- TCTCAACCACTGGGCAGAAGATCG -3'

Sequencing Primer
(F):5'- AAGGCTCTTATGGCATTCAGGAC -3'
(R):5'- GAAGATCGTCTTCTCATCACACG -3'
Posted On2013-06-12