Incidental Mutation 'R6063:Eps8l1'
ID483909
Institutional Source Beutler Lab
Gene Symbol Eps8l1
Ensembl Gene ENSMUSG00000006154
Gene NameEPS8-like 1
Synonyms4632407K17Rik, 2310051G19Rik, DRC3, EPS8R1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6063 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location4460674-4480487 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4471297 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 256 (S256T)
Ref Sequence ENSEMBL: ENSMUSP00000133206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086372] [ENSMUST00000163137] [ENSMUST00000163804] [ENSMUST00000163893] [ENSMUST00000167298] [ENSMUST00000167810] [ENSMUST00000169820] [ENSMUST00000170635] [ENSMUST00000171445]
Predicted Effect probably benign
Transcript: ENSMUST00000086372
AA Change: S195T

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000083559
Gene: ENSMUSG00000006154
AA Change: S195T

DomainStartEndE-ValueType
Pfam:PTB 35 165 2.1e-46 PFAM
low complexity region 282 304 N/A INTRINSIC
SH3 480 535 2.62e-11 SMART
low complexity region 554 564 N/A INTRINSIC
PDB:1WWU|A 632 698 1e-19 PDB
low complexity region 701 715 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146199
Predicted Effect probably benign
Transcript: ENSMUST00000163137
SMART Domains Protein: ENSMUSP00000131345
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 100 1.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163804
Predicted Effect probably benign
Transcript: ENSMUST00000163893
AA Change: S195T

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000125840
Gene: ENSMUSG00000006154
AA Change: S195T

DomainStartEndE-ValueType
Pfam:PTB 35 165 2.1e-46 PFAM
low complexity region 282 304 N/A INTRINSIC
SH3 480 535 2.62e-11 SMART
low complexity region 554 564 N/A INTRINSIC
PDB:1WWU|A 632 698 1e-19 PDB
low complexity region 701 715 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167068
Predicted Effect probably benign
Transcript: ENSMUST00000167298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167599
Predicted Effect probably benign
Transcript: ENSMUST00000167810
SMART Domains Protein: ENSMUSP00000126720
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 152 5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169820
SMART Domains Protein: ENSMUSP00000131773
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 93 1.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170423
Predicted Effect probably benign
Transcript: ENSMUST00000170635
SMART Domains Protein: ENSMUSP00000127999
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
PDB:2CY5|A 26 52 3e-13 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000171445
AA Change: S256T

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133206
Gene: ENSMUSG00000006154
AA Change: S256T

DomainStartEndE-ValueType
Pfam:PTB 96 226 5.8e-46 PFAM
low complexity region 343 365 N/A INTRINSIC
SH3 541 596 2.62e-11 SMART
low complexity region 615 625 N/A INTRINSIC
PDB:1WWU|A 693 759 1e-19 PDB
low complexity region 762 776 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171665
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to epidermal growth factor receptor pathway substrate 8 (EPS8), a substrate for the epidermal growth factor receptor. The function of this protein is unknown. At least two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,264,344 R1713C unknown Het
Ano6 C T 15: 95,948,417 T512I probably damaging Het
Ap3s1 T C 18: 46,754,438 V46A probably benign Het
Art2a-ps C A 7: 101,555,206 V42F probably damaging Het
Asph C T 4: 9,531,960 V386M probably benign Het
B4galnt4 T A 7: 141,064,730 D179E probably benign Het
Bbx T C 16: 50,251,367 I232V probably benign Het
C1ql2 A G 1: 120,341,592 I159V probably benign Het
Ccar1 A G 10: 62,776,717 V223A possibly damaging Het
Cd2ap A T 17: 42,825,911 L277I probably benign Het
Cfap44 G A 16: 44,429,892 E778K probably benign Het
Chd3 A T 11: 69,349,237 D1626E probably benign Het
Crocc C T 4: 141,041,721 G505S probably benign Het
Crocc T A 4: 141,046,540 Q72L probably damaging Het
Drosha T C 15: 12,834,070 probably benign Het
F830045P16Rik A G 2: 129,474,390 V133A probably damaging Het
Fermt2 A T 14: 45,459,881 M671K possibly damaging Het
Fhdc1 G A 3: 84,446,029 L630F probably benign Het
Gm9125 A G 3: 94,050,101 F7L probably benign Het
Gon4l T C 3: 88,899,999 S1667P probably damaging Het
Greb1l A C 18: 10,557,340 K1780T probably damaging Het
H2-Q10 C T 17: 35,470,129 T8M probably benign Het
Hmcn2 A T 2: 31,434,713 T4215S probably benign Het
I0C0044D17Rik G A 4: 98,820,339 probably benign Het
Ifi204 A G 1: 173,751,657 F541L probably benign Het
Igkv6-17 C T 6: 70,371,780 A45V probably damaging Het
Intu G A 3: 40,654,094 A161T probably damaging Het
Kcnmb2 A G 3: 32,178,992 Y73C probably damaging Het
Lrit1 T C 14: 37,054,988 F22L probably benign Het
Lrp1b A T 2: 41,284,144 C699* probably null Het
Lrrc8d A G 5: 105,812,126 D134G probably benign Het
Map1b T C 13: 99,431,137 D1692G unknown Het
Met C T 6: 17,491,968 S243F probably damaging Het
Mlph C A 1: 90,928,160 H96Q probably damaging Het
Mycbp2 A T 14: 103,135,146 V4088D probably damaging Het
Nampt T A 12: 32,848,659 S425T probably damaging Het
Nts G A 10: 102,484,995 H78Y probably benign Het
Nxf1 A G 19: 8,767,787 E467G possibly damaging Het
Olfml2a C A 2: 38,951,143 D230E probably benign Het
Olfr142 C A 2: 90,252,427 C187F probably benign Het
Olfr668 C T 7: 104,925,392 R124H probably benign Het
Pcsk5 A G 19: 17,454,681 probably null Het
Pde5a C A 3: 122,824,925 T629K probably benign Het
Plcb3 G T 19: 6,962,834 R462S possibly damaging Het
Pnpla6 T A 8: 3,524,156 M469K probably benign Het
Pram1 A T 17: 33,641,412 K318* probably null Het
Prkd1 T C 12: 50,342,043 R906G probably benign Het
Ptprh T A 7: 4,573,362 T300S possibly damaging Het
Rdh16f2 A G 10: 127,876,874 Y247C probably benign Het
Rimbp3 A G 16: 17,210,917 E735G probably damaging Het
Sall3 G A 18: 80,974,255 P153S possibly damaging Het
Samd4b T A 7: 28,423,631 M1L possibly damaging Het
Sept12 T C 16: 4,992,263 E136G probably damaging Het
Shpk A T 11: 73,213,444 K140* probably null Het
Sidt1 G T 16: 44,259,466 F608L probably benign Het
Skint5 A G 4: 113,490,645 Y1300H probably benign Het
Slc22a28 G A 19: 8,117,022 P212S probably benign Het
Slc22a5 A T 11: 53,867,533 F480L possibly damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc3a1 C T 17: 85,028,523 P31L probably benign Het
Slc4a7 T C 14: 14,793,964 V1074A possibly damaging Het
Snx2 C T 18: 53,209,625 Q254* probably null Het
Sox30 G A 11: 45,991,942 V600I probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Tdrd7 A G 4: 46,005,486 T431A probably benign Het
Tenm2 A T 11: 36,163,717 probably null Het
Tigar A G 6: 127,091,201 S85P probably benign Het
Tnr A C 1: 159,912,684 M1143L probably benign Het
Trio G T 15: 27,891,379 Q429K possibly damaging Het
Urb1 T C 16: 90,789,097 I452M probably benign Het
Uroc1 A T 6: 90,347,928 E461V probably benign Het
Vax1 C A 19: 59,168,604 R99L unknown Het
Xab2 A T 8: 3,613,051 I510N possibly damaging Het
Zbtb34 A T 2: 33,411,830 I233K possibly damaging Het
Zfp27 A G 7: 29,894,302 F746S probably damaging Het
Zfp651 A G 9: 121,763,532 E306G probably benign Het
Zfp719 C T 7: 43,589,626 Q213* probably null Het
Zswim6 T C 13: 107,728,577 noncoding transcript Het
Other mutations in Eps8l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Eps8l1 APN 7 4478920 utr 3 prime probably benign
IGL01455:Eps8l1 APN 7 4478923 utr 3 prime probably benign
IGL01872:Eps8l1 APN 7 4472296 splice site probably benign
IGL02343:Eps8l1 APN 7 4472124 missense probably benign 0.04
IGL02585:Eps8l1 APN 7 4469213 missense probably damaging 1.00
IGL02596:Eps8l1 APN 7 4470872 missense probably damaging 0.99
IGL02673:Eps8l1 APN 7 4478732 missense probably damaging 1.00
IGL03117:Eps8l1 APN 7 4470887 missense probably damaging 1.00
anamnestic UTSW 7 4470874 missense probably damaging 0.98
souvenir UTSW 7 4477896 missense possibly damaging 0.56
PIT4142001:Eps8l1 UTSW 7 4471415 missense probably benign 0.00
PIT4151001:Eps8l1 UTSW 7 4471415 missense probably benign 0.00
PIT4480001:Eps8l1 UTSW 7 4471415 missense probably benign 0.00
R0015:Eps8l1 UTSW 7 4477557 splice site probably benign
R0599:Eps8l1 UTSW 7 4477957 missense possibly damaging 0.90
R0686:Eps8l1 UTSW 7 4477450 missense probably benign 0.36
R0827:Eps8l1 UTSW 7 4477389 missense possibly damaging 0.86
R1015:Eps8l1 UTSW 7 4469933 missense probably damaging 1.00
R1447:Eps8l1 UTSW 7 4474056 missense probably damaging 1.00
R1490:Eps8l1 UTSW 7 4470889 missense probably damaging 1.00
R1527:Eps8l1 UTSW 7 4471394 missense probably benign
R1553:Eps8l1 UTSW 7 4477449 missense probably damaging 0.98
R1763:Eps8l1 UTSW 7 4471823 missense probably benign 0.43
R1863:Eps8l1 UTSW 7 4465360 utr 5 prime probably benign
R2357:Eps8l1 UTSW 7 4470355 missense probably benign 0.06
R3153:Eps8l1 UTSW 7 4471799 missense probably damaging 1.00
R4082:Eps8l1 UTSW 7 4470798 splice site probably null
R4539:Eps8l1 UTSW 7 4478624 missense probably damaging 1.00
R4684:Eps8l1 UTSW 7 4473945 missense probably damaging 0.99
R4930:Eps8l1 UTSW 7 4460916 missense possibly damaging 0.66
R4931:Eps8l1 UTSW 7 4471241 missense possibly damaging 0.95
R5245:Eps8l1 UTSW 7 4470874 missense probably damaging 0.98
R5247:Eps8l1 UTSW 7 4470402 missense probably damaging 1.00
R5305:Eps8l1 UTSW 7 4477896 missense possibly damaging 0.56
R5420:Eps8l1 UTSW 7 4470161 intron probably null
R5620:Eps8l1 UTSW 7 4460946 missense possibly damaging 0.83
R5705:Eps8l1 UTSW 7 4470035 missense probably benign 0.00
R6909:Eps8l1 UTSW 7 4469900 nonsense probably null
R7096:Eps8l1 UTSW 7 4474191 missense probably benign 0.01
R7136:Eps8l1 UTSW 7 4477404 missense probably damaging 1.00
R7144:Eps8l1 UTSW 7 4472185 missense probably damaging 1.00
R7539:Eps8l1 UTSW 7 4470037 missense not run
X0060:Eps8l1 UTSW 7 4470851 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTTTCTCATTATGAAATGCCCAGC -3'
(R):5'- TGCCACGTTCCTGAATCTCG -3'

Posted On2017-07-14