Incidental Mutation 'R6064:Vnn1'
ID 483978
Institutional Source Beutler Lab
Gene Symbol Vnn1
Ensembl Gene ENSMUSG00000037440
Gene Name vanin 1
Synonyms V-1, pantetheinase
MMRRC Submission 044228-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.163) question?
Stock # R6064 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 23770586-23781241 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 23770807 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 12 (A12S)
Ref Sequence ENSEMBL: ENSMUSP00000040599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041416]
AlphaFold Q9Z0K8
Predicted Effect probably benign
Transcript: ENSMUST00000041416
AA Change: A12S

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000040599
Gene: ENSMUSG00000037440
AA Change: A12S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:CN_hydrolase 52 279 2.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219254
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vanin family of proteins, which share extensive sequence similarity with each other, and also with biotinidase. The family includes secreted and membrane-associated proteins, a few of which have been reported to participate in hematopoietic cell trafficking. No biotinidase activity has been demonstrated for any of the vanin proteins, however, they possess pantetheinase activity, which may play a role in oxidative-stress response. This protein, like its mouse homolog, is likely a GPI-anchored cell surface molecule. The mouse protein is expressed by the perivascular thymic stromal cells and regulates migration of T-cell progenitors to the thymus. This gene lies in close proximity to, and in the same transcriptional orientation as, two other vanin genes on chromosome 6q23-q24. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for disruptions of this gene develop normally and so no abnormalities in the maturation of lymphoid organs. However, membrane bound pantetheinase is absent in livers and kidneys resuulting in an absence of cysteamine in these organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 50,117,667 (GRCm39) D1294N probably damaging Het
Atf1 A G 15: 100,150,029 (GRCm39) T92A probably benign Het
Bach1 A G 16: 87,526,752 (GRCm39) D738G probably damaging Het
Catsper3 T C 13: 55,954,065 (GRCm39) F278L probably damaging Het
Chsy3 GT G 18: 59,309,238 (GRCm39) 163 probably null Het
Cmya5 T A 13: 93,226,157 (GRCm39) N2977I probably damaging Het
Cnbd1 T A 4: 18,895,084 (GRCm39) E219D probably benign Het
Dst A G 1: 34,233,132 (GRCm39) D3556G probably damaging Het
Duox1 A G 2: 122,151,243 (GRCm39) E306G probably benign Het
Fstl5 T A 3: 76,229,605 (GRCm39) F135L probably benign Het
Fyb1 A C 15: 6,668,349 (GRCm39) K514T probably damaging Het
Gsap T A 5: 21,434,223 (GRCm39) C280S possibly damaging Het
Lrig1 T C 6: 94,603,428 (GRCm39) E240G probably damaging Het
Macc1 A T 12: 119,409,400 (GRCm39) H56L probably benign Het
Mroh2a GCCC GC 1: 88,159,979 (GRCm39) probably null Het
Muc6 T C 7: 141,234,640 (GRCm39) R696G probably damaging Het
Nup210 T C 6: 91,032,273 (GRCm39) I32V probably benign Het
Or52n2c C T 7: 104,574,599 (GRCm39) R124H probably benign Het
Or5d16 A G 2: 87,773,828 (GRCm39) M48T probably benign Het
Or5h17 T G 16: 58,820,186 (GRCm39) I46S probably damaging Het
Ovch2 T C 7: 107,395,779 (GRCm39) T80A probably damaging Het
Rad51ap2 T A 12: 11,507,418 (GRCm39) Y447N possibly damaging Het
Rb1cc1 A G 1: 6,319,958 (GRCm39) T1126A probably benign Het
Scgb1b10 T C 7: 31,800,627 (GRCm39) L72S probably damaging Het
Slc25a33 A G 4: 149,836,921 (GRCm39) V141A probably benign Het
Tbx21 T C 11: 97,005,737 (GRCm39) Y76C probably damaging Het
Tmem235 T C 11: 117,753,764 (GRCm39) V107A possibly damaging Het
Zfp606 T G 7: 12,214,960 (GRCm39) W63G possibly damaging Het
Zfp788 T A 7: 41,297,878 (GRCm39) F119L probably benign Het
Other mutations in Vnn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Vnn1 APN 10 23,776,677 (GRCm39) missense possibly damaging 0.51
IGL01299:Vnn1 APN 10 23,770,949 (GRCm39) missense probably damaging 1.00
IGL01353:Vnn1 APN 10 23,776,738 (GRCm39) missense probably damaging 1.00
IGL01774:Vnn1 APN 10 23,776,608 (GRCm39) missense probably benign 0.26
IGL01970:Vnn1 APN 10 23,773,300 (GRCm39) missense probably benign 0.06
IGL01985:Vnn1 APN 10 23,776,642 (GRCm39) missense probably benign 0.00
IGL02019:Vnn1 APN 10 23,779,449 (GRCm39) missense possibly damaging 0.69
IGL02198:Vnn1 APN 10 23,779,323 (GRCm39) missense probably benign 0.00
IGL02349:Vnn1 APN 10 23,774,401 (GRCm39) missense possibly damaging 0.91
IGL02738:Vnn1 APN 10 23,780,520 (GRCm39) missense probably benign 0.00
IGL03058:Vnn1 APN 10 23,780,442 (GRCm39) missense probably benign 0.06
R0008:Vnn1 UTSW 10 23,774,500 (GRCm39) critical splice donor site probably null
R0030:Vnn1 UTSW 10 23,776,744 (GRCm39) missense probably benign 0.08
R0508:Vnn1 UTSW 10 23,770,910 (GRCm39) missense probably benign 0.01
R0781:Vnn1 UTSW 10 23,775,499 (GRCm39) missense possibly damaging 0.46
R1110:Vnn1 UTSW 10 23,775,499 (GRCm39) missense possibly damaging 0.46
R1757:Vnn1 UTSW 10 23,776,727 (GRCm39) missense probably benign 0.00
R1757:Vnn1 UTSW 10 23,776,726 (GRCm39) missense possibly damaging 0.49
R1778:Vnn1 UTSW 10 23,775,415 (GRCm39) missense possibly damaging 0.67
R2011:Vnn1 UTSW 10 23,770,869 (GRCm39) nonsense probably null
R2055:Vnn1 UTSW 10 23,776,475 (GRCm39) splice site probably benign
R2158:Vnn1 UTSW 10 23,776,653 (GRCm39) nonsense probably null
R2186:Vnn1 UTSW 10 23,773,299 (GRCm39) missense probably benign 0.29
R4277:Vnn1 UTSW 10 23,774,410 (GRCm39) missense possibly damaging 0.89
R4279:Vnn1 UTSW 10 23,774,410 (GRCm39) missense possibly damaging 0.89
R4473:Vnn1 UTSW 10 23,770,789 (GRCm39) missense probably benign
R4590:Vnn1 UTSW 10 23,775,303 (GRCm39) missense possibly damaging 0.61
R4708:Vnn1 UTSW 10 23,773,250 (GRCm39) missense probably benign 0.01
R4794:Vnn1 UTSW 10 23,776,602 (GRCm39) missense probably benign 0.01
R5266:Vnn1 UTSW 10 23,779,303 (GRCm39) missense probably damaging 1.00
R5495:Vnn1 UTSW 10 23,774,462 (GRCm39) missense probably damaging 0.98
R7081:Vnn1 UTSW 10 23,770,903 (GRCm39) missense possibly damaging 0.66
R7088:Vnn1 UTSW 10 23,776,645 (GRCm39) missense probably benign 0.00
R7221:Vnn1 UTSW 10 23,770,952 (GRCm39) missense probably benign 0.07
R7334:Vnn1 UTSW 10 23,776,658 (GRCm39) missense probably benign 0.04
R8784:Vnn1 UTSW 10 23,780,526 (GRCm39) missense probably benign
R8859:Vnn1 UTSW 10 23,780,484 (GRCm39) missense probably benign 0.01
R8926:Vnn1 UTSW 10 23,776,587 (GRCm39) missense probably benign 0.04
R8987:Vnn1 UTSW 10 23,776,714 (GRCm39) missense probably damaging 0.98
R9002:Vnn1 UTSW 10 23,775,349 (GRCm39) missense possibly damaging 0.82
R9091:Vnn1 UTSW 10 23,780,464 (GRCm39) missense probably damaging 1.00
R9270:Vnn1 UTSW 10 23,780,464 (GRCm39) missense probably damaging 1.00
R9276:Vnn1 UTSW 10 23,776,794 (GRCm39) missense probably damaging 1.00
R9453:Vnn1 UTSW 10 23,776,723 (GRCm39) missense probably damaging 0.96
R9557:Vnn1 UTSW 10 23,776,723 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCATTCCTGACCAGAGAACTAAG -3'
(R):5'- TAGGATACCTGCTTCGCTGC -3'

Sequencing Primer
(F):5'- CTGAAACTGTTGCTTTCAGGGAC -3'
(R):5'- TTCGCTGCAGATACGATCG -3'
Posted On 2017-07-14