Incidental Mutation 'R6065:Gm3453'
ID484017
Institutional Source Beutler Lab
Gene Symbol Gm3453
Ensembl Gene ENSMUSG00000090643
Gene Namepredicted gene 3453
Synonyms
MMRRC Submission 044229-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R6065 (G1)
Quality Score167.009
Status Not validated
Chromosome14
Chromosomal Location5970744-5979137 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5978233 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 57 (T57A)
Ref Sequence ENSEMBL: ENSMUSP00000131479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170686] [ENSMUST00000178308]
Predicted Effect probably damaging
Transcript: ENSMUST00000170686
AA Change: T57A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131479
Gene: ENSMUSG00000090643
AA Change: T57A

DomainStartEndE-ValueType
Pfam:Takusan 46 129 9.8e-32 PFAM
transmembrane domain 240 262 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000178308
AA Change: T57A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137254
Gene: ENSMUSG00000090643
AA Change: T57A

DomainStartEndE-ValueType
Pfam:Takusan 46 129 5.7e-32 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff1 T C 5: 103,842,252 S871P probably damaging Het
BC055324 A T 1: 163,959,388 L704Q probably benign Het
BC055324 A G 1: 163,987,688 M88T probably damaging Het
Ccdc150 T C 1: 54,263,599 I126T possibly damaging Het
Ccdc87 A T 19: 4,841,240 M587L probably benign Het
Cd300ld2 G A 11: 115,012,602 probably benign Het
Chsy3 GT G 18: 59,176,166 probably null Het
Dchs1 T C 7: 105,755,421 D2638G probably damaging Het
Dnah5 A T 15: 28,230,468 I171F possibly damaging Het
Dnah9 T C 11: 65,855,338 D3983G probably benign Het
Dnah9 A G 11: 66,145,397 S396P possibly damaging Het
Fbxw15 T A 9: 109,568,178 D18V probably damaging Het
Fcnb A C 2: 28,079,910 C106G probably damaging Het
Grin2a T C 16: 9,761,907 D164G possibly damaging Het
Hmcn1 C T 1: 150,770,330 V706I probably benign Het
Kcnj12 C T 11: 61,069,877 L334F probably damaging Het
Lama3 T C 18: 12,469,928 Y1057H possibly damaging Het
Mycbpap T C 11: 94,508,187 probably null Het
Myo18b A G 5: 112,692,781 L2382P probably benign Het
Ngef T A 1: 87,477,648 N680I probably damaging Het
Nop2 A G 6: 125,144,565 H770R probably benign Het
Pcdhgc3 A G 18: 37,807,676 T377A possibly damaging Het
Prl7b1 T C 13: 27,604,546 K109E probably benign Het
Ptprk C T 10: 28,475,170 T553I probably damaging Het
Rab3d T C 9: 21,910,519 T209A probably benign Het
Ralgapa1 A G 12: 55,757,924 probably null Het
Rspry1 T C 8: 94,622,987 M1T probably null Het
Sec13 G T 6: 113,730,832 P176T probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc4a7 C A 14: 14,739,836 T236K probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Syt2 A G 1: 134,747,557 N382S probably benign Het
Tm7sf2 A G 19: 6,063,386 M345T possibly damaging Het
Ubr4 T G 4: 139,421,238 C1678G probably damaging Het
Urb1 A G 16: 90,803,332 S188P probably benign Het
Vmn2r82 A G 10: 79,385,376 S524G probably damaging Het
Wdr19 A G 5: 65,221,713 N233S probably benign Het
Other mutations in Gm3453
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02951:Gm3453 APN 14 5976168 missense possibly damaging 0.63
R5575:Gm3453 UTSW 14 5978205 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GGGAGATGACATACTCCATTCATG -3'
(R):5'- AGCTTAGCAAACCAGCTGG -3'

Posted On2017-07-14