Incidental Mutation 'R6066:Rsph6a'
ID 484039
Institutional Source Beutler Lab
Gene Symbol Rsph6a
Ensembl Gene ENSMUSG00000040866
Gene Name radial spoke head 6 homolog A (Chlamydomonas)
Synonyms Rshl1, RSP4
MMRRC Submission 044230-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R6066 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 18788615-18808372 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 18799740 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 457 (P457L)
Ref Sequence ENSEMBL: ENSMUSP00000046526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035521] [ENSMUST00000076887]
AlphaFold Q8CDR2
Predicted Effect probably damaging
Transcript: ENSMUST00000035521
AA Change: P457L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046526
Gene: ENSMUSG00000040866
AA Change: P457L

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:Radial_spoke 191 685 2.3e-200 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076887
SMART Domains Protein: ENSMUSP00000076153
Gene: ENSMUSG00000040866

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:Radial_spoke 188 287 3e-18 PFAM
Pfam:Radial_spoke 285 433 4.6e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144991
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to a sea urchin radial spoke head protein. Radial spoke protein complexes form part of the axoneme of eukaryotic flagella and are located between the axoneme's outer ring of doublet microtubules and central pair of microtubules. In Chlamydomonas, radial spoke proteins are thought to regulate the activity of dynein and the symmetry of flagellar bending patterns. This gene maps to a region of chromosome 19 that is linked to primary ciliary dyskinesia-2 (CILD2). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Adgrb1 T C 15: 74,412,308 (GRCm39) F429S probably damaging Het
Ahi1 A T 10: 20,835,825 (GRCm39) M53L possibly damaging Het
Ahr A T 12: 35,554,920 (GRCm39) F400I probably damaging Het
Ak7 G T 12: 105,699,750 (GRCm39) G223V possibly damaging Het
Alpk3 A G 7: 80,726,698 (GRCm39) I128V possibly damaging Het
Ampd3 A T 7: 110,392,974 (GRCm39) E247D probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 64,922,910 (GRCm39) probably null Het
Arhgef10l A G 4: 140,304,391 (GRCm39) F243L probably damaging Het
Cdh23 A T 10: 60,269,537 (GRCm39) V661E probably damaging Het
Cox8c A G 12: 102,866,534 (GRCm39) T53A probably benign Het
Creld2 C A 15: 88,707,969 (GRCm39) T236K possibly damaging Het
Cul3 A T 1: 80,261,476 (GRCm39) C250S probably benign Het
Dhx37 A C 5: 125,501,730 (GRCm39) F510V probably benign Het
Fblim1 T C 4: 141,305,220 (GRCm39) D350G probably damaging Het
Lipm A G 19: 34,090,374 (GRCm39) Y185C probably damaging Het
Mfsd4b4 A G 10: 39,768,049 (GRCm39) F348S probably benign Het
Misp A G 10: 79,662,146 (GRCm39) R188G possibly damaging Het
Nbeal1 T G 1: 60,287,564 (GRCm39) I936S probably benign Het
Ngly1 G A 14: 16,294,634 (GRCm38) M521I probably benign Het
Nlrp9a A T 7: 26,257,510 (GRCm39) Y376F probably benign Het
Oas3 T C 5: 120,910,989 (GRCm39) K197R probably damaging Het
Pars2 T C 4: 106,511,276 (GRCm39) Y353H probably damaging Het
Pik3r1 T C 13: 101,822,828 (GRCm39) N625D possibly damaging Het
Pkhd1l1 T A 15: 44,391,525 (GRCm39) S1530R probably damaging Het
Secisbp2 T C 13: 51,831,258 (GRCm39) S565P probably benign Het
Slc28a3 T C 13: 58,726,301 (GRCm39) M163V probably benign Het
Slc35e2 C T 4: 155,694,483 (GRCm39) P10L probably benign Het
Svil T G 18: 5,106,724 (GRCm39) V1855G probably damaging Het
Szt2 T C 4: 118,229,171 (GRCm39) T2890A unknown Het
Tatdn3 A T 1: 190,778,465 (GRCm39) V242E probably benign Het
Vmn1r22 T G 6: 57,877,864 (GRCm39) M38L probably benign Het
Vmn2r104 A G 17: 20,258,573 (GRCm39) F524L possibly damaging Het
Vmn2r94 A G 17: 18,477,695 (GRCm39) S239P probably damaging Het
Xpo7 T C 14: 70,919,778 (GRCm39) D679G probably null Het
Zbtb42 C A 12: 112,646,041 (GRCm39) T72K probably damaging Het
Zfp493 G A 13: 67,935,069 (GRCm39) A341T possibly damaging Het
Zfp811 A G 17: 33,017,801 (GRCm39) C80R possibly damaging Het
Other mutations in Rsph6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Rsph6a APN 7 18,788,793 (GRCm39) nonsense probably null
IGL01656:Rsph6a APN 7 18,788,770 (GRCm39) missense probably benign 0.00
IGL02997:Rsph6a APN 7 18,788,764 (GRCm39) missense probably benign 0.32
R0396:Rsph6a UTSW 7 18,808,031 (GRCm39) missense probably damaging 1.00
R0467:Rsph6a UTSW 7 18,791,594 (GRCm39) missense possibly damaging 0.95
R0545:Rsph6a UTSW 7 18,788,871 (GRCm39) nonsense probably null
R0603:Rsph6a UTSW 7 18,799,886 (GRCm39) missense possibly damaging 0.66
R0848:Rsph6a UTSW 7 18,791,595 (GRCm39) missense probably benign 0.07
R1943:Rsph6a UTSW 7 18,808,001 (GRCm39) missense probably damaging 1.00
R2133:Rsph6a UTSW 7 18,802,031 (GRCm39) missense probably damaging 1.00
R3713:Rsph6a UTSW 7 18,791,475 (GRCm39) missense probably damaging 0.98
R3762:Rsph6a UTSW 7 18,789,256 (GRCm39) missense probably damaging 1.00
R3826:Rsph6a UTSW 7 18,791,539 (GRCm39) missense probably damaging 1.00
R3827:Rsph6a UTSW 7 18,791,539 (GRCm39) missense probably damaging 1.00
R3828:Rsph6a UTSW 7 18,791,539 (GRCm39) missense probably damaging 1.00
R4355:Rsph6a UTSW 7 18,801,003 (GRCm39) splice site probably null
R4429:Rsph6a UTSW 7 18,807,988 (GRCm39) missense probably damaging 1.00
R4524:Rsph6a UTSW 7 18,799,970 (GRCm39) missense probably damaging 1.00
R4799:Rsph6a UTSW 7 18,799,783 (GRCm39) nonsense probably null
R4896:Rsph6a UTSW 7 18,791,665 (GRCm39) missense possibly damaging 0.67
R4906:Rsph6a UTSW 7 18,801,997 (GRCm39) missense possibly damaging 0.92
R5004:Rsph6a UTSW 7 18,791,665 (GRCm39) missense possibly damaging 0.67
R5637:Rsph6a UTSW 7 18,788,820 (GRCm39) missense probably benign
R7013:Rsph6a UTSW 7 18,788,820 (GRCm39) missense probably benign
R7193:Rsph6a UTSW 7 18,799,572 (GRCm39) missense probably damaging 1.00
R7689:Rsph6a UTSW 7 18,801,962 (GRCm39) missense possibly damaging 0.64
R8170:Rsph6a UTSW 7 18,791,505 (GRCm39) missense probably damaging 1.00
R8177:Rsph6a UTSW 7 18,808,164 (GRCm39) missense unknown
R8956:Rsph6a UTSW 7 18,799,364 (GRCm39) intron probably benign
R9032:Rsph6a UTSW 7 18,799,250 (GRCm39) missense probably damaging 1.00
R9085:Rsph6a UTSW 7 18,799,250 (GRCm39) missense probably damaging 1.00
R9222:Rsph6a UTSW 7 18,801,986 (GRCm39) missense possibly damaging 0.88
R9529:Rsph6a UTSW 7 18,799,535 (GRCm39) missense probably benign 0.15
R9654:Rsph6a UTSW 7 18,799,332 (GRCm39) missense probably damaging 0.99
R9672:Rsph6a UTSW 7 18,799,842 (GRCm39) missense probably damaging 1.00
Z1177:Rsph6a UTSW 7 18,799,856 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCCACATGTGCCGCTTCTG -3'
(R):5'- TCAAAGTCGGGGTTCTCCTC -3'

Sequencing Primer
(F):5'- CTTCTGGGGCAAGATCCTG -3'
(R):5'- AAGTCGGGGTTCTCCTCAAAGG -3'
Posted On 2017-07-14