Incidental Mutation 'R6051:2010300C02Rik'
List |< first << previous [record 95 of 18188] next >> last >|
ID484067
Institutional Source Beutler Lab
Gene Symbol 2010300C02Rik
Ensembl Gene ENSMUSG00000026090
Gene NameRIKEN cDNA 2010300C02 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R6051 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location37611677-37720085 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 37624225 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 864 (P864Q)
Ref Sequence ENSEMBL: ENSMUSP00000123803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162875]
Predicted Effect unknown
Transcript: ENSMUST00000160023
AA Change: P339Q
SMART Domains Protein: ENSMUSP00000125015
Gene: ENSMUSG00000026090
AA Change: P339Q

DomainStartEndE-ValueType
internal_repeat_1 2 65 4.52e-24 PROSPERO
internal_repeat_1 65 128 4.52e-24 PROSPERO
low complexity region 181 194 N/A INTRINSIC
low complexity region 223 237 N/A INTRINSIC
low complexity region 263 279 N/A INTRINSIC
low complexity region 441 465 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162875
AA Change: P864Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123803
Gene: ENSMUSG00000026090
AA Change: P864Q

DomainStartEndE-ValueType
low complexity region 13 43 N/A INTRINSIC
Pfam:DUF4592 130 243 1.8e-33 PFAM
low complexity region 347 366 N/A INTRINSIC
internal_repeat_2 387 461 2.31e-5 PROSPERO
internal_repeat_3 404 474 3.67e-5 PROSPERO
internal_repeat_1 411 526 3.02e-34 PROSPERO
internal_repeat_2 485 559 2.31e-5 PROSPERO
internal_repeat_1 537 652 3.02e-34 PROSPERO
internal_repeat_3 570 698 3.67e-5 PROSPERO
low complexity region 705 718 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 965 989 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G T 1: 105,721,272 G712V probably damaging Het
2700049A03Rik G T 12: 71,184,530 A1021S possibly damaging Het
Abl2 A G 1: 156,642,085 D869G probably damaging Het
Adamts9 G A 6: 92,859,926 A615V possibly damaging Het
Adamts9 A G 6: 92,890,118 Y96H probably damaging Het
Arhgef37 A G 18: 61,507,274 I238T probably damaging Het
Atr T A 9: 95,908,369 H1587Q possibly damaging Het
BB014433 T C 8: 15,042,179 T225A possibly damaging Het
Bcas2 T C 3: 103,174,341 Y87H possibly damaging Het
Brca1 C T 11: 101,524,246 E160K probably damaging Het
Cd2ap T C 17: 42,796,328 *638W probably null Het
Chd2 A T 7: 73,435,842 D1681E probably benign Het
Cit C T 5: 115,846,405 P12L probably benign Het
Crisp1 T C 17: 40,305,126 Y120C possibly damaging Het
Cyp2c65 A G 19: 39,061,166 D46G probably benign Het
Cyp2d34 A T 15: 82,616,770 V387D probably damaging Het
E130311K13Rik T C 3: 63,915,641 H194R probably benign Het
Egfr C A 11: 16,883,607 T625N possibly damaging Het
Fat3 A G 9: 16,375,455 V924A possibly damaging Het
Fgd6 T C 10: 94,137,565 probably null Het
Galnt6 A T 15: 100,694,668 C553S probably damaging Het
Gm5617 T C 9: 48,495,887 L107P possibly damaging Het
Hectd1 G T 12: 51,754,104 T2035N probably benign Het
Hp1bp3 A G 4: 138,234,304 T154A possibly damaging Het
Il10rb A G 16: 91,421,864 T262A probably benign Het
Kansl1l A T 1: 66,726,726 N403K probably null Het
Kbtbd12 T C 6: 88,617,948 D300G possibly damaging Het
Lama4 G A 10: 39,067,902 A734T probably benign Het
Mllt6 G T 11: 97,680,743 G1069* probably null Het
Mns1 T C 9: 72,449,453 L302P probably damaging Het
Muc5ac T A 7: 141,811,857 C2039S possibly damaging Het
Myof A G 19: 38,024,361 L42P probably damaging Het
Ncoa3 T C 2: 166,058,765 L868S probably damaging Het
Ndc80 C T 17: 71,517,578 G212E probably benign Het
Ntn4 A G 10: 93,745,795 H610R probably benign Het
Nufip2 T A 11: 77,691,916 Y219N probably damaging Het
Olfr631 T C 7: 103,928,877 F18S probably damaging Het
Pbxip1 T C 3: 89,443,170 S41P probably benign Het
Phactr2 A T 10: 13,261,811 C196S probably null Het
Ppp3ca T A 3: 136,876,122 Y140N probably damaging Het
Ptprb C A 10: 116,341,090 Y1260* probably null Het
Rap1a C T 3: 105,750,297 R2H possibly damaging Het
Rbbp8 G A 18: 11,738,607 V794I probably benign Het
Rbks T C 5: 31,651,819 N200S probably damaging Het
Rnf186 G T 4: 138,967,966 K272N probably damaging Het
Rtl1 G A 12: 109,593,024 P794S probably damaging Het
Tbc1d30 T A 10: 121,296,845 I205F probably damaging Het
Tkt C T 14: 30,568,196 P261S probably benign Het
Trp53 G A 11: 69,589,608 R267H possibly damaging Het
Ttc14 T C 3: 33,808,924 probably benign Het
Ttn A G 2: 76,907,461 S4245P probably benign Het
Vmn1r75 A T 7: 11,881,051 I237F probably damaging Het
Vmn2r57 T A 7: 41,448,472 H57L probably benign Het
Wdr62 T C 7: 30,261,384 N40S possibly damaging Het
Xcr1 A T 9: 123,856,116 F194I probably benign Het
Zmiz1 T A 14: 25,572,070 M1K probably null Het
Other mutations in 2010300C02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:2010300C02Rik APN 1 37628344 missense probably damaging 0.99
IGL01413:2010300C02Rik APN 1 37612306 missense possibly damaging 0.85
IGL01812:2010300C02Rik APN 1 37625365 missense probably benign 0.06
IGL02183:2010300C02Rik APN 1 37625378 missense possibly damaging 0.93
IGL02498:2010300C02Rik APN 1 37623845
IGL02713:2010300C02Rik APN 1 37624137 missense possibly damaging 0.72
IGL02736:2010300C02Rik APN 1 37637873 missense probably damaging 1.00
FR4449:2010300C02Rik UTSW 1 37625035 missense probably benign 0.40
FR4449:2010300C02Rik UTSW 1 37625036 nonsense probably null
FR4548:2010300C02Rik UTSW 1 37625035 missense probably benign 0.40
FR4548:2010300C02Rik UTSW 1 37625036 nonsense probably null
FR4548:2010300C02Rik UTSW 1 37625102 missense probably damaging 0.96
FR4737:2010300C02Rik UTSW 1 37625035 missense probably benign 0.40
FR4737:2010300C02Rik UTSW 1 37625036 nonsense probably null
FR4976:2010300C02Rik UTSW 1 37625035 missense probably benign 0.40
FR4976:2010300C02Rik UTSW 1 37625036 nonsense probably null
FR4976:2010300C02Rik UTSW 1 37625102 missense probably damaging 0.96
R0022:2010300C02Rik UTSW 1 37628245 missense probably damaging 1.00
R0022:2010300C02Rik UTSW 1 37628245 missense probably damaging 1.00
R0055:2010300C02Rik UTSW 1 37624256 missense probably benign 0.18
R0153:2010300C02Rik UTSW 1 37624639 missense probably benign
R0523:2010300C02Rik UTSW 1 37644629 start codon destroyed probably null 0.94
R0699:2010300C02Rik UTSW 1 37612330 missense possibly damaging 0.85
R0928:2010300C02Rik UTSW 1 37624582 missense possibly damaging 0.85
R1457:2010300C02Rik UTSW 1 37626012 nonsense probably null
R1759:2010300C02Rik UTSW 1 37625710 missense probably benign 0.00
R1888:2010300C02Rik UTSW 1 37624283 missense possibly damaging 0.53
R1888:2010300C02Rik UTSW 1 37624283 missense possibly damaging 0.53
R2289:2010300C02Rik UTSW 1 37612261 missense possibly damaging 0.53
R2421:2010300C02Rik UTSW 1 37613475 missense probably benign 0.33
R2422:2010300C02Rik UTSW 1 37613475 missense probably benign 0.33
R2509:2010300C02Rik UTSW 1 37625300 missense probably benign
R2510:2010300C02Rik UTSW 1 37625300 missense probably benign
R2511:2010300C02Rik UTSW 1 37625300 missense probably benign
R3893:2010300C02Rik UTSW 1 37631458 missense probably benign 0.00
R4351:2010300C02Rik UTSW 1 37624912 missense probably benign
R4454:2010300C02Rik UTSW 1 37624753 missense probably damaging 1.00
R4788:2010300C02Rik UTSW 1 37631475 missense probably damaging 1.00
R4798:2010300C02Rik UTSW 1 37624965 missense probably benign 0.12
R5599:2010300C02Rik UTSW 1 37613343 missense possibly damaging 0.53
R5920:2010300C02Rik UTSW 1 37637981 missense probably damaging 1.00
R6106:2010300C02Rik UTSW 1 37613412 missense possibly damaging 0.53
R6794:2010300C02Rik UTSW 1 37637855 splice site probably null
R6828:2010300C02Rik UTSW 1 37624817 missense possibly damaging 0.53
R6930:2010300C02Rik UTSW 1 37624945 missense possibly damaging 0.73
X0025:2010300C02Rik UTSW 1 37624945 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CTGTTCATCTTTGGGAAGCAGAG -3'
(R):5'- CCTTCCGGAGTATTCTGCAC -3'

Sequencing Primer
(F):5'- AGAGCCAGGCCTCCTTTC -3'
(R):5'- CCGGAGTATTCTGCACATGTG -3'
Posted On2017-07-14