Incidental Mutation 'R6051:Hp1bp3'
ID484079
Institutional Source Beutler Lab
Gene Symbol Hp1bp3
Ensembl Gene ENSMUSG00000028759
Gene Nameheterochromatin protein 1, binding protein 3
SynonymsHp1bp74
MMRRC Submission 044219-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.769) question?
Stock #R6051 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location138216296-138244683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138234304 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 154 (T154A)
Ref Sequence ENSEMBL: ENSMUSP00000122005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030541] [ENSMUST00000097836] [ENSMUST00000105825] [ENSMUST00000105826] [ENSMUST00000105827] [ENSMUST00000137851] [ENSMUST00000148681] [ENSMUST00000165861]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030541
AA Change: T318A

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030541
Gene: ENSMUSG00000028759
AA Change: T318A

DomainStartEndE-ValueType
low complexity region 96 133 N/A INTRINSIC
H15 157 224 2.82e-18 SMART
H15 253 320 7.29e-12 SMART
H15 335 403 1.78e-15 SMART
low complexity region 427 451 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097836
AA Change: T280A

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095447
Gene: ENSMUSG00000028759
AA Change: T280A

DomainStartEndE-ValueType
low complexity region 58 95 N/A INTRINSIC
H15 119 186 2.82e-18 SMART
H15 215 282 7.29e-12 SMART
H15 297 365 1.78e-15 SMART
low complexity region 389 413 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105825
AA Change: T280A

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101451
Gene: ENSMUSG00000028759
AA Change: T280A

DomainStartEndE-ValueType
low complexity region 58 95 N/A INTRINSIC
H15 119 186 1.3e-17 SMART
H15 215 282 7.29e-12 SMART
H15 297 365 1.78e-15 SMART
low complexity region 389 413 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105826
AA Change: T318A

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101452
Gene: ENSMUSG00000028759
AA Change: T318A

DomainStartEndE-ValueType
low complexity region 96 133 N/A INTRINSIC
H15 157 224 1.3e-17 SMART
H15 253 320 7.29e-12 SMART
H15 335 403 1.78e-15 SMART
low complexity region 427 451 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105827
AA Change: T318A

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101453
Gene: ENSMUSG00000028759
AA Change: T318A

DomainStartEndE-ValueType
low complexity region 96 133 N/A INTRINSIC
H15 157 224 1.3e-17 SMART
H15 253 320 7.29e-12 SMART
H15 335 403 1.78e-15 SMART
low complexity region 427 451 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137851
SMART Domains Protein: ENSMUSP00000118913
Gene: ENSMUSG00000028759

DomainStartEndE-ValueType
low complexity region 58 95 N/A INTRINSIC
H15 119 186 1.3e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000148681
AA Change: T154A

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122005
Gene: ENSMUSG00000028759
AA Change: T154A

DomainStartEndE-ValueType
H15 3 60 2.05e-6 SMART
H15 89 156 7.29e-12 SMART
H15 171 239 1.78e-15 SMART
low complexity region 263 287 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155344
Predicted Effect possibly damaging
Transcript: ENSMUST00000165861
AA Change: T318A

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132614
Gene: ENSMUSG00000028759
AA Change: T318A

DomainStartEndE-ValueType
low complexity region 96 133 N/A INTRINSIC
H15 157 224 2.82e-18 SMART
H15 253 320 7.29e-12 SMART
H15 335 403 1.78e-15 SMART
low complexity region 427 451 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality and reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik G T 1: 37,624,225 P864Q probably damaging Het
2310035C23Rik G T 1: 105,721,272 G712V probably damaging Het
2700049A03Rik G T 12: 71,184,530 A1021S possibly damaging Het
Abl2 A G 1: 156,642,085 D869G probably damaging Het
Adamts9 A G 6: 92,890,118 Y96H probably damaging Het
Adamts9 G A 6: 92,859,926 A615V possibly damaging Het
Arhgef37 A G 18: 61,507,274 I238T probably damaging Het
Atr T A 9: 95,908,369 H1587Q possibly damaging Het
BB014433 T C 8: 15,042,179 T225A possibly damaging Het
Bcas2 T C 3: 103,174,341 Y87H possibly damaging Het
Brca1 C T 11: 101,524,246 E160K probably damaging Het
Cd2ap T C 17: 42,796,328 *638W probably null Het
Chd2 A T 7: 73,435,842 D1681E probably benign Het
Cit C T 5: 115,846,405 P12L probably benign Het
Crisp1 T C 17: 40,305,126 Y120C possibly damaging Het
Cyp2c65 A G 19: 39,061,166 D46G probably benign Het
Cyp2d34 A T 15: 82,616,770 V387D probably damaging Het
E130311K13Rik T C 3: 63,915,641 H194R probably benign Het
Egfr C A 11: 16,883,607 T625N possibly damaging Het
Fat3 A G 9: 16,375,455 V924A possibly damaging Het
Fgd6 T C 10: 94,137,565 probably null Het
Galnt6 A T 15: 100,694,668 C553S probably damaging Het
Gm5617 T C 9: 48,495,887 L107P possibly damaging Het
Hectd1 G T 12: 51,754,104 T2035N probably benign Het
Il10rb A G 16: 91,421,864 T262A probably benign Het
Kansl1l A T 1: 66,726,726 N704K probably null Het
Kbtbd12 T C 6: 88,617,948 D300G possibly damaging Het
Lama4 G A 10: 39,067,902 A734T probably benign Het
Mllt6 G T 11: 97,680,743 G1069* probably null Het
Mns1 T C 9: 72,449,453 L302P probably damaging Het
Muc5ac T A 7: 141,811,857 C2039S possibly damaging Het
Myof A G 19: 38,024,361 L42P probably damaging Het
Ncoa3 T C 2: 166,058,765 L868S probably damaging Het
Ndc80 C T 17: 71,517,578 G212E probably benign Het
Ntn4 A G 10: 93,745,795 H610R probably benign Het
Nufip2 T A 11: 77,691,916 Y219N probably damaging Het
Olfr631 T C 7: 103,928,877 F18S probably damaging Het
Pbxip1 T C 3: 89,443,170 S41P probably benign Het
Phactr2 A T 10: 13,261,811 C196S probably null Het
Ppp3ca T A 3: 136,876,122 Y140N probably damaging Het
Ptprb C A 10: 116,341,090 Y1260* probably null Het
Rap1a C T 3: 105,750,297 R2H possibly damaging Het
Rbbp8 G A 18: 11,738,607 V794I probably benign Het
Rbks T C 5: 31,651,819 N200S probably damaging Het
Rnf186 G T 4: 138,967,966 K272N probably damaging Het
Rtl1 G A 12: 109,593,024 P794S probably damaging Het
Tbc1d30 T A 10: 121,296,845 I205F probably damaging Het
Tkt C T 14: 30,568,196 P261S probably benign Het
Trp53 G A 11: 69,589,608 R267H possibly damaging Het
Ttc14 T C 3: 33,808,924 probably benign Het
Ttn A G 2: 76,907,461 S4245P probably benign Het
Vmn1r75 A T 7: 11,881,051 I237F probably damaging Het
Vmn2r57 T A 7: 41,448,472 H57L probably benign Het
Wdr62 T C 7: 30,261,384 N40S possibly damaging Het
Xcr1 A T 9: 123,856,116 F194I probably benign Het
Zmiz1 T A 14: 25,572,070 M1K probably null Het
Other mutations in Hp1bp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Hp1bp3 APN 4 138240629 missense possibly damaging 0.85
IGL02407:Hp1bp3 APN 4 138240672 missense probably damaging 1.00
IGL03036:Hp1bp3 APN 4 138228732 missense probably damaging 1.00
Supermicro UTSW 4 138225897 missense probably damaging 1.00
R0009:Hp1bp3 UTSW 4 138221683 missense probably benign 0.45
R0009:Hp1bp3 UTSW 4 138221683 missense probably benign 0.45
R0128:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0130:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0131:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0131:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0132:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0344:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0522:Hp1bp3 UTSW 4 138222161 missense possibly damaging 0.77
R0652:Hp1bp3 UTSW 4 138228769 missense possibly damaging 0.75
R1240:Hp1bp3 UTSW 4 138229698 missense probably damaging 1.00
R1793:Hp1bp3 UTSW 4 138230509 missense probably damaging 1.00
R1871:Hp1bp3 UTSW 4 138222186 missense probably damaging 1.00
R2018:Hp1bp3 UTSW 4 138221632 missense probably damaging 1.00
R2060:Hp1bp3 UTSW 4 138240672 missense probably damaging 1.00
R2255:Hp1bp3 UTSW 4 138225898 missense probably damaging 0.98
R3721:Hp1bp3 UTSW 4 138239608 missense probably damaging 1.00
R3930:Hp1bp3 UTSW 4 138221707 missense probably benign 0.29
R5042:Hp1bp3 UTSW 4 138222108 start codon destroyed probably null 0.99
R5423:Hp1bp3 UTSW 4 138225897 missense probably damaging 1.00
R5583:Hp1bp3 UTSW 4 138222115 missense probably damaging 1.00
R5597:Hp1bp3 UTSW 4 138221628 start codon destroyed possibly damaging 0.91
R6208:Hp1bp3 UTSW 4 138217170 start gained probably benign
R7077:Hp1bp3 UTSW 4 138239618 missense probably damaging 1.00
X0027:Hp1bp3 UTSW 4 138241673 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCTGCTTGTCCAGGATGC -3'
(R):5'- TATCACACTCATCTATTGCTGGG -3'

Sequencing Primer
(F):5'- CAGGATGCCTGCGGTTTG -3'
(R):5'- GAGACATGGCCTCTCTATGTAG -3'
Posted On2017-07-14