Incidental Mutation 'R6053:Adamts4'
ID484209
Institutional Source Beutler Lab
Gene Symbol Adamts4
Ensembl Gene ENSMUSG00000006403
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 4
Synonymsaggrecanase-1, ADAM-TS4
MMRRC Submission 044221-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6053 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location171250421-171260637 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 171252715 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 279 (I279N)
Ref Sequence ENSEMBL: ENSMUSP00000151387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111314] [ENSMUST00000111315] [ENSMUST00000191871] [ENSMUST00000194778] [ENSMUST00000219033]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111314
AA Change: I82N

PolyPhen 2 Score 0.544 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106946
Gene: ENSMUSG00000006403
AA Change: I82N

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
Pfam:Reprolysin_5 27 214 1.8e-12 PFAM
Pfam:Reprolysin 29 239 1e-19 PFAM
Pfam:Reprolysin_4 33 235 1.2e-10 PFAM
Pfam:Reprolysin_3 50 183 5.4e-12 PFAM
Pfam:Reprolysin_2 50 229 1.9e-9 PFAM
Blast:ACR 240 319 4e-24 BLAST
TSP1 334 386 3.52e-14 SMART
Pfam:ADAM_spacer1 497 614 5.2e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111315
AA Change: I267N

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106947
Gene: ENSMUSG00000006403
AA Change: I267N

DomainStartEndE-ValueType
signal peptide 1 49 N/A INTRINSIC
Pfam:Pep_M12B_propep 54 177 5.6e-17 PFAM
Pfam:Reprolysin_5 212 399 6.5e-12 PFAM
Pfam:Reprolysin 214 424 4.6e-19 PFAM
Pfam:Reprolysin_4 219 420 4.6e-10 PFAM
Pfam:Reprolysin_3 235 368 1.9e-11 PFAM
Pfam:Reprolysin_2 236 414 7.2e-9 PFAM
Blast:ACR 425 504 4e-24 BLAST
TSP1 519 571 3.52e-14 SMART
Pfam:ADAM_spacer1 682 799 1.8e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191871
SMART Domains Protein: ENSMUSP00000141942
Gene: ENSMUSG00000013593

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 114 146 5.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194778
SMART Domains Protein: ENSMUSP00000141370
Gene: ENSMUSG00000013593

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 166 231 3.4e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000219033
AA Change: I279N

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active zinc-dependent aggrecanase enzyme that degrades cartilage. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutant mice do not exhibit any morphological abnormalities. However, they do display impaired coordination and an increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,188,461 D785G probably benign Het
Abca4 T C 3: 122,171,017 Y2158H probably damaging Het
Acap1 T G 11: 69,887,070 probably null Het
Akap3 A G 6: 126,866,533 E705G probably damaging Het
Arap3 C A 18: 37,990,771 L398F probably damaging Het
BC067074 C A 13: 113,320,726 P1102Q possibly damaging Het
Catsperg1 A T 7: 29,210,814 L34* probably null Het
Ccdc171 T G 4: 83,795,219 L1165R probably damaging Het
Ccdc3 G A 2: 5,229,027 V221I probably benign Het
Cdc42ep4 T A 11: 113,728,986 H193L probably damaging Het
Clcn1 G A 6: 42,300,274 W361* probably null Het
Cntn2 T C 1: 132,518,352 N832S probably benign Het
Col5a1 A T 2: 28,014,377 probably benign Het
Ctc1 T A 11: 69,027,901 M550K probably benign Het
Dennd5a T C 7: 109,933,745 R273G probably damaging Het
Dnajb7 T C 15: 81,407,299 E279G probably benign Het
Dopey1 G T 9: 86,515,294 G882W possibly damaging Het
Dvl2 A G 11: 70,005,993 R238G possibly damaging Het
Ect2l A T 10: 18,141,844 L629Q probably damaging Het
Enpp1 T C 10: 24,657,126 D497G possibly damaging Het
Ep400 T C 5: 110,755,795 M313V probably benign Het
Epn2 T C 11: 61,546,497 Y83C probably damaging Het
Ercc3 T G 18: 32,246,754 V338G probably damaging Het
Fkbp5 T C 17: 28,428,466 I132V probably benign Het
Fn1 A T 1: 71,599,290 Y1846N probably damaging Het
Foxg1 T C 12: 49,385,378 L298P possibly damaging Het
Foxo3 G A 10: 42,197,214 P436S probably benign Het
Gbx2 T C 1: 89,930,437 T107A probably benign Het
Gli1 G T 10: 127,334,315 H324N probably damaging Het
Gnas T A 2: 174,299,852 S605T possibly damaging Het
Ica1 C T 6: 8,630,783 A431T probably benign Het
Il10ra C T 9: 45,256,303 D319N probably damaging Het
Jmjd4 T A 11: 59,454,044 H274Q probably damaging Het
Krt28 C A 11: 99,371,201 L294F probably benign Het
Ltbp3 C A 19: 5,752,094 T766K probably damaging Het
Man2b2 C A 5: 36,813,038 M841I probably benign Het
Mmp14 T A 14: 54,435,890 M85K probably benign Het
Mmp1b T A 9: 7,385,031 D206V probably benign Het
Muc5b T C 7: 141,864,708 F3797S probably benign Het
Mug1 A G 6: 121,865,738 D561G probably benign Het
Myo18a T A 11: 77,818,176 H471Q probably damaging Het
Nfkb2 A G 19: 46,311,812 E873G probably damaging Het
Ngfr G A 11: 95,571,006 H361Y possibly damaging Het
Nnt T C 13: 119,357,509 T679A possibly damaging Het
Notch1 A T 2: 26,472,912 N947K probably benign Het
Nrg4 A T 9: 55,236,490 V94D probably benign Het
Nsd1 G T 13: 55,293,609 C1631F probably damaging Het
Nutm1 T C 2: 112,249,090 T827A probably benign Het
Olfr1219 T C 2: 89,074,554 D179G probably damaging Het
Olfr187 A T 16: 59,035,988 Y250N probably damaging Het
Olfr328 T A 11: 58,552,066 M58L possibly damaging Het
Olfr414 C A 1: 174,430,569 S47* probably null Het
Olfr883 TTGCTGT TTGCTGTCTGCTGT 9: 38,026,541 probably null Het
Orai3 C T 7: 127,773,878 P184S probably benign Het
Paqr3 A T 5: 97,111,278 S56T probably benign Het
Pard6b C T 2: 168,099,053 T320M possibly damaging Het
Pgs1 T C 11: 118,001,709 S166P probably damaging Het
Plaa T C 4: 94,589,884 T114A probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plin4 A T 17: 56,108,618 D73E probably benign Het
Plxnb1 T C 9: 109,111,707 L1550P probably damaging Het
Rbak A C 5: 143,174,682 Y205* probably null Het
Rgs12 T C 5: 34,965,952 F360L probably benign Het
Rgs22 A T 15: 36,100,007 D187E probably benign Het
Sec24d C T 3: 123,279,222 Q66* probably null Het
Sh2d5 T A 4: 138,255,562 M85K probably damaging Het
Sos1 A G 17: 80,415,034 V861A possibly damaging Het
Stk11ip T A 1: 75,534,255 probably null Het
Svs1 A G 6: 48,988,488 T477A probably benign Het
Tmem26 G A 10: 68,748,484 E127K probably benign Het
Tmem41a T G 16: 21,934,989 T211P possibly damaging Het
Tmem69 T A 4: 116,553,384 M130L possibly damaging Het
Trak2 C A 1: 58,904,069 R726L possibly damaging Het
Vmn1r231 A G 17: 20,889,819 I278T probably damaging Het
Vwf G A 6: 125,600,665 V490I probably benign Het
Wdr33 C T 18: 31,878,063 T255I possibly damaging Het
Ylpm1 G T 12: 84,996,503 W5L possibly damaging Het
Zfp169 A T 13: 48,498,858 W28R probably damaging Het
Other mutations in Adamts4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Adamts4 APN 1 171252850 missense probably damaging 1.00
IGL02496:Adamts4 APN 1 171250943 missense probably benign 0.00
IGL02510:Adamts4 APN 1 171251390 missense probably benign 0.08
IGL02695:Adamts4 APN 1 171252634 missense probably damaging 1.00
IGL02952:Adamts4 APN 1 171251348 missense probably damaging 1.00
IGL03010:Adamts4 APN 1 171251416 missense probably damaging 1.00
IGL03304:Adamts4 APN 1 171252869 splice site probably benign
PIT4305001:Adamts4 UTSW 1 171259041 missense probably benign
R0331:Adamts4 UTSW 1 171250972 missense probably benign 0.00
R1302:Adamts4 UTSW 1 171253183 missense probably damaging 1.00
R1460:Adamts4 UTSW 1 171256440 splice site probably benign
R1502:Adamts4 UTSW 1 171258990 missense probably damaging 1.00
R1544:Adamts4 UTSW 1 171252742 missense probably benign 0.09
R1815:Adamts4 UTSW 1 171256336 missense probably damaging 0.99
R1982:Adamts4 UTSW 1 171258934 missense probably benign 0.00
R1986:Adamts4 UTSW 1 171256675 missense possibly damaging 0.94
R2281:Adamts4 UTSW 1 171256229 missense probably damaging 1.00
R4261:Adamts4 UTSW 1 171259104 missense probably benign 0.01
R4750:Adamts4 UTSW 1 171251066 missense probably benign
R4868:Adamts4 UTSW 1 171252431 intron probably benign
R4924:Adamts4 UTSW 1 171259074 missense probably damaging 0.97
R5418:Adamts4 UTSW 1 171252574 missense probably damaging 1.00
R5468:Adamts4 UTSW 1 171252609 missense probably benign
R5566:Adamts4 UTSW 1 171250850 start codon destroyed probably null 0.90
R5781:Adamts4 UTSW 1 171251015 missense possibly damaging 0.89
R6043:Adamts4 UTSW 1 171252601 missense probably damaging 1.00
R6187:Adamts4 UTSW 1 171250993 missense probably damaging 1.00
R6614:Adamts4 UTSW 1 171256624 missense probably benign 0.07
R6976:Adamts4 UTSW 1 171252308 intron probably benign
R7291:Adamts4 UTSW 1 171256528 missense probably benign
X0062:Adamts4 UTSW 1 171256549 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTGAGTAGATTCGTGGAGAC -3'
(R):5'- GGCATCTTCTCCATCATGGC -3'

Sequencing Primer
(F):5'- CACTGGTGGTAGCAGATGAC -3'
(R):5'- ATCATGGCCCGTGGAGTG -3'
Posted On2017-07-14