Incidental Mutation 'R6053:Dennd5a'
ID484236
Institutional Source Beutler Lab
Gene Symbol Dennd5a
Ensembl Gene ENSMUSG00000035901
Gene NameDENN/MADD domain containing 5A
Synonyms1500012B19Rik, Rab6ip1, ORF37
MMRRC Submission 044221-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R6053 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location109893780-109960470 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109933745 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 273 (R273G)
Ref Sequence ENSEMBL: ENSMUSP00000079295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080437] [ENSMUST00000106722]
PDB Structure
Strucure of RAB6(GTP)-R6IP1 complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000080437
AA Change: R273G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079295
Gene: ENSMUSG00000035901
AA Change: R273G

DomainStartEndE-ValueType
uDENN 12 138 7.71e-45 SMART
DENN 202 390 9.28e-80 SMART
dDENN 512 588 4.06e-21 SMART
low complexity region 832 844 N/A INTRINSIC
RUN 884 947 4.9e-22 SMART
Pfam:PLAT 956 1062 1e-15 PFAM
RUN 1218 1278 3.69e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106722
AA Change: R249G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102333
Gene: ENSMUSG00000035901
AA Change: R249G

DomainStartEndE-ValueType
uDENN 12 114 2.32e-39 SMART
DENN 178 366 9.28e-80 SMART
dDENN 488 564 4.06e-21 SMART
low complexity region 808 820 N/A INTRINSIC
RUN 860 923 4.9e-22 SMART
Pfam:PLAT 932 1038 2.8e-18 PFAM
RUN 1194 1254 3.69e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151923
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN-domain-containing protein that functions as a RAB-activating guanine nucleotide exchange factor (GEF). This protein catalyzes the conversion of GDP to GTP and thereby converts inactive GDP-bound Rab proteins into their active GTP-bound form. The encoded protein is recruited by RAB6 onto Golgi membranes and is therefore referred to as RAB6-interacting protein 1. This protein binds with RAB39 as well. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene are associated with early infantile epileptic encephalopathy-49. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,188,461 D785G probably benign Het
Abca4 T C 3: 122,171,017 Y2158H probably damaging Het
Acap1 T G 11: 69,887,070 probably null Het
Adamts4 T A 1: 171,252,715 I279N possibly damaging Het
Akap3 A G 6: 126,866,533 E705G probably damaging Het
Arap3 C A 18: 37,990,771 L398F probably damaging Het
BC067074 C A 13: 113,320,726 P1102Q possibly damaging Het
Catsperg1 A T 7: 29,210,814 L34* probably null Het
Ccdc171 T G 4: 83,795,219 L1165R probably damaging Het
Ccdc3 G A 2: 5,229,027 V221I probably benign Het
Cdc42ep4 T A 11: 113,728,986 H193L probably damaging Het
Clcn1 G A 6: 42,300,274 W361* probably null Het
Cntn2 T C 1: 132,518,352 N832S probably benign Het
Col5a1 A T 2: 28,014,377 probably benign Het
Ctc1 T A 11: 69,027,901 M550K probably benign Het
Dnajb7 T C 15: 81,407,299 E279G probably benign Het
Dopey1 G T 9: 86,515,294 G882W possibly damaging Het
Dvl2 A G 11: 70,005,993 R238G possibly damaging Het
Ect2l A T 10: 18,141,844 L629Q probably damaging Het
Enpp1 T C 10: 24,657,126 D497G possibly damaging Het
Ep400 T C 5: 110,755,795 M313V probably benign Het
Epn2 T C 11: 61,546,497 Y83C probably damaging Het
Ercc3 T G 18: 32,246,754 V338G probably damaging Het
Fkbp5 T C 17: 28,428,466 I132V probably benign Het
Fn1 A T 1: 71,599,290 Y1846N probably damaging Het
Foxg1 T C 12: 49,385,378 L298P possibly damaging Het
Foxo3 G A 10: 42,197,214 P436S probably benign Het
Gbx2 T C 1: 89,930,437 T107A probably benign Het
Gli1 G T 10: 127,334,315 H324N probably damaging Het
Gnas T A 2: 174,299,852 S605T possibly damaging Het
Ica1 C T 6: 8,630,783 A431T probably benign Het
Il10ra C T 9: 45,256,303 D319N probably damaging Het
Jmjd4 T A 11: 59,454,044 H274Q probably damaging Het
Krt28 C A 11: 99,371,201 L294F probably benign Het
Ltbp3 C A 19: 5,752,094 T766K probably damaging Het
Man2b2 C A 5: 36,813,038 M841I probably benign Het
Mmp14 T A 14: 54,435,890 M85K probably benign Het
Mmp1b T A 9: 7,385,031 D206V probably benign Het
Muc5b T C 7: 141,864,708 F3797S probably benign Het
Mug1 A G 6: 121,865,738 D561G probably benign Het
Myo18a T A 11: 77,818,176 H471Q probably damaging Het
Nfkb2 A G 19: 46,311,812 E873G probably damaging Het
Ngfr G A 11: 95,571,006 H361Y possibly damaging Het
Nnt T C 13: 119,357,509 T679A possibly damaging Het
Notch1 A T 2: 26,472,912 N947K probably benign Het
Nrg4 A T 9: 55,236,490 V94D probably benign Het
Nsd1 G T 13: 55,293,609 C1631F probably damaging Het
Nutm1 T C 2: 112,249,090 T827A probably benign Het
Olfr1219 T C 2: 89,074,554 D179G probably damaging Het
Olfr187 A T 16: 59,035,988 Y250N probably damaging Het
Olfr328 T A 11: 58,552,066 M58L possibly damaging Het
Olfr414 C A 1: 174,430,569 S47* probably null Het
Olfr883 TTGCTGT TTGCTGTCTGCTGT 9: 38,026,541 probably null Het
Orai3 C T 7: 127,773,878 P184S probably benign Het
Paqr3 A T 5: 97,111,278 S56T probably benign Het
Pard6b C T 2: 168,099,053 T320M possibly damaging Het
Pgs1 T C 11: 118,001,709 S166P probably damaging Het
Plaa T C 4: 94,589,884 T114A probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plin4 A T 17: 56,108,618 D73E probably benign Het
Plxnb1 T C 9: 109,111,707 L1550P probably damaging Het
Rbak A C 5: 143,174,682 Y205* probably null Het
Rgs12 T C 5: 34,965,952 F360L probably benign Het
Rgs22 A T 15: 36,100,007 D187E probably benign Het
Sec24d C T 3: 123,279,222 Q66* probably null Het
Sh2d5 T A 4: 138,255,562 M85K probably damaging Het
Sos1 A G 17: 80,415,034 V861A possibly damaging Het
Stk11ip T A 1: 75,534,255 probably null Het
Svs1 A G 6: 48,988,488 T477A probably benign Het
Tmem26 G A 10: 68,748,484 E127K probably benign Het
Tmem41a T G 16: 21,934,989 T211P possibly damaging Het
Tmem69 T A 4: 116,553,384 M130L possibly damaging Het
Trak2 C A 1: 58,904,069 R726L possibly damaging Het
Vmn1r231 A G 17: 20,889,819 I278T probably damaging Het
Vwf G A 6: 125,600,665 V490I probably benign Het
Wdr33 C T 18: 31,878,063 T255I possibly damaging Het
Ylpm1 G T 12: 84,996,503 W5L possibly damaging Het
Zfp169 A T 13: 48,498,858 W28R probably damaging Het
Other mutations in Dennd5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Dennd5a APN 7 109908372 missense probably benign
IGL01338:Dennd5a APN 7 109919404 missense possibly damaging 0.92
IGL01618:Dennd5a APN 7 109934095 missense probably damaging 1.00
IGL02047:Dennd5a APN 7 109934784 missense possibly damaging 0.92
IGL02277:Dennd5a APN 7 109897969 missense possibly damaging 0.61
IGL02492:Dennd5a APN 7 109933637 missense probably benign
IGL02697:Dennd5a APN 7 109894781 missense probably damaging 1.00
IGL02935:Dennd5a APN 7 109921307 missense possibly damaging 0.80
IGL02986:Dennd5a APN 7 109935524 missense probably benign
IGL03088:Dennd5a APN 7 109908381 missense probably damaging 1.00
IGL03156:Dennd5a APN 7 109919255 splice site probably benign
IGL03181:Dennd5a APN 7 109933658 missense probably damaging 1.00
big_pal UTSW 7 109919423 nonsense probably null
Celestial UTSW 7 109901089 missense probably damaging 1.00
PIT4434001:Dennd5a UTSW 7 109933624 missense probably damaging 1.00
R0055:Dennd5a UTSW 7 109899791 missense possibly damaging 0.72
R0055:Dennd5a UTSW 7 109899791 missense possibly damaging 0.72
R0092:Dennd5a UTSW 7 109899806 missense possibly damaging 0.95
R0111:Dennd5a UTSW 7 109934754 missense probably damaging 1.00
R0517:Dennd5a UTSW 7 109934761 missense probably damaging 1.00
R0546:Dennd5a UTSW 7 109921426 missense probably benign 0.01
R0811:Dennd5a UTSW 7 109933613 missense possibly damaging 0.93
R0812:Dennd5a UTSW 7 109933613 missense possibly damaging 0.93
R0827:Dennd5a UTSW 7 109899731 missense probably damaging 1.00
R0831:Dennd5a UTSW 7 109934754 missense probably damaging 1.00
R1075:Dennd5a UTSW 7 109918601 missense probably benign
R1115:Dennd5a UTSW 7 109918761 missense probably damaging 1.00
R1128:Dennd5a UTSW 7 109921334 nonsense probably null
R1300:Dennd5a UTSW 7 109919407 missense probably benign
R1698:Dennd5a UTSW 7 109917380 splice site probably null
R1711:Dennd5a UTSW 7 109918712 missense probably benign 0.00
R1771:Dennd5a UTSW 7 109918686 missense probably damaging 0.98
R1803:Dennd5a UTSW 7 109898613 missense probably benign 0.00
R2064:Dennd5a UTSW 7 109898693 splice site probably benign
R2176:Dennd5a UTSW 7 109905120 intron probably null
R2182:Dennd5a UTSW 7 109933994 missense probably benign 0.03
R2852:Dennd5a UTSW 7 109933671 missense probably damaging 1.00
R2853:Dennd5a UTSW 7 109933671 missense probably damaging 1.00
R3035:Dennd5a UTSW 7 109921352 missense probably benign 0.00
R3835:Dennd5a UTSW 7 109934242 missense probably benign 0.00
R3953:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R3954:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R3955:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R3957:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R4014:Dennd5a UTSW 7 109935481 critical splice donor site probably null
R4166:Dennd5a UTSW 7 109926825 critical splice donor site probably null
R4362:Dennd5a UTSW 7 109896343 missense probably damaging 1.00
R4567:Dennd5a UTSW 7 109899735 missense probably benign 0.06
R4700:Dennd5a UTSW 7 109921198 missense probably benign 0.01
R4734:Dennd5a UTSW 7 109896336 missense probably damaging 0.96
R4914:Dennd5a UTSW 7 109901089 missense probably damaging 1.00
R4915:Dennd5a UTSW 7 109901089 missense probably damaging 1.00
R4918:Dennd5a UTSW 7 109901089 missense probably damaging 1.00
R4992:Dennd5a UTSW 7 109894712 missense probably damaging 0.98
R5011:Dennd5a UTSW 7 109914776 missense possibly damaging 0.89
R5013:Dennd5a UTSW 7 109914776 missense possibly damaging 0.89
R5034:Dennd5a UTSW 7 109899797 missense probably damaging 0.98
R5194:Dennd5a UTSW 7 109933729 missense probably damaging 1.00
R5359:Dennd5a UTSW 7 109897962 missense probably damaging 1.00
R5430:Dennd5a UTSW 7 109934240 missense probably damaging 1.00
R5586:Dennd5a UTSW 7 109905721 missense possibly damaging 0.72
R5607:Dennd5a UTSW 7 109919423 nonsense probably null
R5608:Dennd5a UTSW 7 109919423 nonsense probably null
R5783:Dennd5a UTSW 7 109894636 missense probably damaging 0.97
R5866:Dennd5a UTSW 7 109919360 missense probably benign 0.00
R5890:Dennd5a UTSW 7 109934221 missense probably benign 0.00
R6247:Dennd5a UTSW 7 109898682 missense probably damaging 1.00
R6362:Dennd5a UTSW 7 109934265 nonsense probably null
R6446:Dennd5a UTSW 7 109894666 missense probably damaging 1.00
R6894:Dennd5a UTSW 7 109901118 missense probably damaging 1.00
R7061:Dennd5a UTSW 7 109905179 missense probably benign 0.19
R7115:Dennd5a UTSW 7 109894754 missense probably damaging 1.00
R7133:Dennd5a UTSW 7 109896242 critical splice donor site probably null
R7302:Dennd5a UTSW 7 109905699 missense probably damaging 0.98
Z1088:Dennd5a UTSW 7 109894747 missense possibly damaging 0.73
Z1088:Dennd5a UTSW 7 109905273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGTGACTATACAAAGCAGGGAGC -3'
(R):5'- AGCAGGGACACACTCTATGTC -3'

Sequencing Primer
(F):5'- AGGGAGCCCACAGGGTG -3'
(R):5'- GGACACACTCTATGTCTCTAAATGC -3'
Posted On2017-07-14