Incidental Mutation 'R0519:Pcdhb21'
ID48427
Institutional Source Beutler Lab
Gene Symbol Pcdhb21
Ensembl Gene ENSMUSG00000044022
Gene Nameprotocadherin beta 21
SynonymsPcdhb18, PcdhbU
MMRRC Submission 038712-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R0519 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37513621-37518325 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37516032 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 738 (V738A)
Ref Sequence ENSEMBL: ENSMUSP00000056424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061405] [ENSMUST00000097609] [ENSMUST00000115661] [ENSMUST00000192409] [ENSMUST00000194544]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061405
AA Change: V738A

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000056424
Gene: ENSMUSG00000044022
AA Change: V738A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Cadherin_2 30 110 4.2e-30 PFAM
CA 153 238 1.8e-17 SMART
CA 262 343 1.54e-25 SMART
CA 367 448 1.03e-21 SMART
CA 472 558 3.41e-27 SMART
CA 588 669 1.54e-11 SMART
Pfam:Cadherin_C_2 686 769 1.5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097609
SMART Domains Protein: ENSMUSP00000095214
Gene: ENSMUSG00000073591

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cadherin_2 28 110 5.8e-32 PFAM
CA 153 238 3.99e-19 SMART
CA 262 343 2.18e-25 SMART
CA 366 447 1.53e-20 SMART
CA 471 557 3.6e-26 SMART
CA 587 668 5.35e-11 SMART
Pfam:Cadherin_C_2 685 768 4.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192409
SMART Domains Protein: ENSMUSP00000141521
Gene: ENSMUSG00000073591

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cadherin_2 27 110 2.5e-32 PFAM
CA 153 238 3.99e-19 SMART
CA 262 343 2.18e-25 SMART
CA 366 447 1.53e-20 SMART
CA 471 557 3.6e-26 SMART
CA 587 668 5.35e-11 SMART
transmembrane domain 689 711 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A G 5: 107,548,201 R168G probably benign Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2810004N23Rik C T 8: 124,839,929 G251R possibly damaging Het
3425401B19Rik A G 14: 32,662,962 S349P possibly damaging Het
Ackr4 A G 9: 104,099,451 V99A probably benign Het
Asxl3 A G 18: 22,523,520 Q1529R possibly damaging Het
Atg12 T C 18: 46,741,410 E46G probably benign Het
Cdcp2 A G 4: 107,107,192 probably benign Het
Clasrp A G 7: 19,584,164 probably benign Het
Clip2 A G 5: 134,516,151 V383A probably benign Het
Cntln C T 4: 85,005,053 probably benign Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Csmd2 A C 4: 128,487,005 Y2118S possibly damaging Het
Dip2c T A 13: 9,563,208 V415E probably damaging Het
Dpy19l2 C T 9: 24,558,095 R755Q probably benign Het
Dsn1 A T 2: 156,998,713 probably benign Het
Dtd2 T C 12: 52,004,959 probably benign Het
Dync1i1 A G 6: 6,027,399 T602A probably benign Het
Ercc6 A C 14: 32,526,842 D450A probably damaging Het
Fgf12 A T 16: 28,189,628 V104D probably benign Het
Frem1 A T 4: 82,970,633 probably null Het
Gcgr G T 11: 120,536,156 W88L probably damaging Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Hapln1 A G 13: 89,584,716 probably benign Het
Hmgn3 T C 9: 83,112,248 E40G probably damaging Het
Hsdl1 G A 8: 119,565,711 A255V probably damaging Het
Hyls1 T C 9: 35,561,203 K306E probably damaging Het
Jcad C T 18: 4,649,122 probably benign Het
Kif14 C A 1: 136,469,147 A397E probably damaging Het
Lcmt2 A T 2: 121,139,344 probably null Het
Lifr T C 15: 7,177,580 L524P probably damaging Het
Ly6g6f T C 17: 35,082,852 K209E possibly damaging Het
Macf1 G A 4: 123,471,320 T1651I probably benign Het
Mapk4 T C 18: 73,970,321 D39G probably damaging Het
Mbl1 A G 14: 41,158,565 M137V probably damaging Het
Mcm10 G A 2: 5,008,545 S92L probably benign Het
Mug1 A G 6: 121,851,424 K265R possibly damaging Het
Mxra7 A G 11: 116,810,786 probably null Het
Neu3 G A 7: 99,823,317 probably benign Het
Nsd1 A G 13: 55,312,835 T2395A probably benign Het
Olfr1034 A T 2: 86,047,067 Y195F probably benign Het
Olfr3 T A 2: 36,812,615 H159L probably damaging Het
Olfr750 T A 14: 51,071,157 I79F probably damaging Het
Olfr854 A T 9: 19,566,949 I145N probably benign Het
Osgepl1 T C 1: 53,321,096 V327A probably damaging Het
Plekha8 A T 6: 54,622,107 probably benign Het
Ptprq A C 10: 107,538,920 probably benign Het
Pus10 T A 11: 23,711,201 F263Y probably benign Het
Rad54b A T 4: 11,599,809 I338F probably damaging Het
Rad54l2 A G 9: 106,708,299 F756L probably damaging Het
Scn11a A G 9: 119,790,119 L719P probably damaging Het
Slc2a2 G A 3: 28,718,816 V253I possibly damaging Het
Slc39a4 A T 15: 76,615,138 N192K probably benign Het
Soat1 T A 1: 156,441,246 I245F probably damaging Het
Sorcs2 G A 5: 36,031,190 A858V probably benign Het
Tcim T C 8: 24,438,635 T88A possibly damaging Het
Tecta G A 9: 42,347,892 probably benign Het
Tgm5 C A 2: 121,048,895 L553F probably damaging Het
Tjp1 A G 7: 65,302,921 V1555A probably benign Het
Tmem214 A C 5: 30,869,668 M1L probably null Het
Togaram1 T C 12: 64,966,002 probably benign Het
Topaz1 C A 9: 122,749,479 L485I possibly damaging Het
Ttn T C 2: 76,718,282 probably benign Het
Ube2o A G 11: 116,546,459 probably null Het
Ubr7 T A 12: 102,768,206 D246E probably benign Het
Vcpkmt T C 12: 69,582,328 D132G probably benign Het
Vmn2r111 T A 17: 22,573,121 Q51H probably benign Het
Vmn2r95 C T 17: 18,439,503 P170S probably damaging Het
Zbtb38 A G 9: 96,685,773 I1086T probably damaging Het
Zfp444 G A 7: 6,188,173 A118T probably benign Het
Zp2 A G 7: 120,138,149 I272T probably damaging Het
Other mutations in Pcdhb21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Pcdhb21 APN 18 37514553 missense probably damaging 1.00
IGL01860:Pcdhb21 APN 18 37514905 missense probably benign 0.00
IGL02139:Pcdhb21 APN 18 37515246 missense probably damaging 1.00
IGL02370:Pcdhb21 APN 18 37514592 unclassified probably null
IGL03108:Pcdhb21 APN 18 37515891 unclassified probably null
IGL03265:Pcdhb21 APN 18 37515153 missense probably damaging 1.00
R0454:Pcdhb21 UTSW 18 37514513 missense probably damaging 1.00
R0647:Pcdhb21 UTSW 18 37513860 missense probably damaging 0.99
R0689:Pcdhb21 UTSW 18 37515317 missense probably benign 0.00
R1607:Pcdhb21 UTSW 18 37515479 missense probably damaging 1.00
R1649:Pcdhb21 UTSW 18 37515613 missense probably damaging 1.00
R1777:Pcdhb21 UTSW 18 37515718 missense possibly damaging 0.80
R1865:Pcdhb21 UTSW 18 37514595 missense possibly damaging 0.95
R4595:Pcdhb21 UTSW 18 37514515 missense probably damaging 1.00
R4888:Pcdhb21 UTSW 18 37515077 missense possibly damaging 0.76
R5281:Pcdhb21 UTSW 18 37513935 missense probably benign 0.00
R5396:Pcdhb21 UTSW 18 37515719 missense probably benign 0.03
R5398:Pcdhb21 UTSW 18 37515719 missense probably benign 0.03
R5399:Pcdhb21 UTSW 18 37515719 missense probably benign 0.03
R5635:Pcdhb21 UTSW 18 37513917 missense probably benign 0.33
R6134:Pcdhb21 UTSW 18 37514408 missense probably benign 0.03
R6387:Pcdhb21 UTSW 18 37515332 missense probably benign 0.35
R6595:Pcdhb21 UTSW 18 37515908 missense probably damaging 1.00
R6750:Pcdhb21 UTSW 18 37514448 missense probably damaging 1.00
R6754:Pcdhb21 UTSW 18 37514683 missense probably benign 0.28
R6928:Pcdhb21 UTSW 18 37514421 missense probably damaging 1.00
Z1088:Pcdhb21 UTSW 18 37514541 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCTGCTGCTAGTCAAGGACAATG -3'
(R):5'- GGAACCATGATGAGAGTCAACAAATTGC -3'

Sequencing Primer
(F):5'- CGACTCTACCCAAGTGGATGAG -3'
(R):5'- GAGTCAACAAATTGCTAATTGTATCC -3'
Posted On2013-06-12