Incidental Mutation 'R5506:Mroh2a'
ID484464
Institutional Source Beutler Lab
Gene Symbol Mroh2a
Ensembl Gene ENSMUSG00000079429
Gene Namemaestro heat-like repeat family member 2A
SynonymsHeatr7b1, ENSMUSG00000044873, OTTMUSG00000020804
MMRRC Submission 043067-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R5506 (G1)
Quality Score21
Status Validated
Chromosome1
Chromosomal Location88226986-88262289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88258664 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 64 (S64G)
Ref Sequence ENSEMBL: ENSMUSP00000118971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000113130] [ENSMUST00000135948]
Predicted Effect probably benign
Transcript: ENSMUST00000054674
SMART Domains Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 11 68 1.5e-10 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Pfam:HJURP_mid 254 370 7.6e-54 PFAM
Pfam:HJURP_C 385 446 3.1e-26 PFAM
low complexity region 496 515 N/A INTRINSIC
Pfam:HJURP_C 527 585 7.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061013
AA Change: S1567G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429
AA Change: S1567G

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113130
AA Change: S1559G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429
AA Change: S1559G

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135948
AA Change: S64G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000118971
Gene: ENSMUSG00000079429
AA Change: S64G

DomainStartEndE-ValueType
SCOP:d1gw5a_ 15 174 5e-6 SMART
Meta Mutation Damage Score 0.152 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HEAT-domain-containing protein. The function of the encoded protein has not been characterized. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,067,947 G966W probably damaging Het
3110002H16Rik A G 18: 12,188,956 probably benign Het
A930009A15Rik G T 10: 115,578,362 probably null Het
Cant1 G T 11: 118,411,442 H16Q probably benign Het
Capn3 G T 2: 120,502,420 V612F probably damaging Het
Cep112 A T 11: 108,664,603 E141D probably damaging Het
Cept1 A G 3: 106,531,248 V173A probably benign Het
CN725425 A G 15: 91,235,826 D50G possibly damaging Het
Cubn A T 2: 13,491,695 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dpp8 A G 9: 65,078,109 probably null Het
Ecm1 G A 3: 95,735,857 T377I probably benign Het
Exosc8 A G 3: 54,731,179 probably benign Het
Fam129b G A 2: 32,920,982 V335M probably damaging Het
Fam71f1 G A 6: 29,319,298 E34K probably damaging Het
Fasn C T 11: 120,809,510 D2165N probably benign Het
Gab2 A G 7: 97,303,113 E571G probably damaging Het
Galnt5 C A 2: 57,999,625 H412Q probably benign Het
Galr1 T A 18: 82,405,864 Y96F possibly damaging Het
Gm8882 T C 6: 132,361,856 N133S unknown Het
Gnl2 C A 4: 125,055,365 probably benign Het
H2afx T C 9: 44,335,105 V115A probably benign Het
Heatr9 T C 11: 83,514,766 N317S possibly damaging Het
Hist1h2an A C 13: 21,786,911 I103S probably damaging Het
Kndc1 A G 7: 139,927,891 Y1254C probably damaging Het
Lrp6 A T 6: 134,459,296 D1302E probably benign Het
Mc2r A T 18: 68,407,948 Y91* probably null Het
Meis1 T G 11: 18,941,747 D267A possibly damaging Het
Mki67 T C 7: 135,699,981 K1108R possibly damaging Het
Myh3 T G 11: 67,084,089 D219E probably damaging Het
Olfr1511 T C 14: 52,390,627 I49V probably damaging Het
Olfr857 T C 9: 19,713,274 L149P possibly damaging Het
Pi4ka A G 16: 17,293,953 C1553R probably damaging Het
Plekhb1 C A 7: 100,644,943 probably null Het
Polr3d A T 14: 70,440,759 D165E possibly damaging Het
Psmb1 A G 17: 15,490,216 Y24H probably damaging Het
Rab11fip5 A G 6: 85,374,137 L131P probably damaging Het
Raph1 A T 1: 60,493,498 probably benign Het
Scgb2b27 T G 7: 34,012,059 probably benign Het
Serpina10 T C 12: 103,626,661 D264G probably damaging Het
Sftpb A G 6: 72,304,667 T15A possibly damaging Het
Slc20a1 T C 2: 129,210,819 F674L probably benign Het
Syne2 A T 12: 75,938,721 N1648Y probably benign Het
Thsd7a G T 6: 12,332,017 N1265K possibly damaging Het
Trem2 T C 17: 48,351,774 L189P probably benign Het
Washc4 A T 10: 83,581,337 R865S probably damaging Het
Zfp536 A G 7: 37,568,792 S400P probably damaging Het
Other mutations in Mroh2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Mroh2a APN 1 88230746 missense probably damaging 0.99
IGL00990:Mroh2a APN 1 88244970 missense probably benign 0.03
IGL00990:Mroh2a APN 1 88234120 missense possibly damaging 0.76
IGL03097:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R0032:Mroh2a UTSW 1 88256166 frame shift probably null
R0068:Mroh2a UTSW 1 88256166 frame shift probably null
R0139:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R0197:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R0242:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0322:Mroh2a UTSW 1 88230680 nonsense probably null
R0374:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0387:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R0412:Mroh2a UTSW 1 88235216 missense probably benign 0.01
R0536:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0548:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0580:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0581:Mroh2a UTSW 1 88256166 frame shift probably null
R0583:Mroh2a UTSW 1 88256166 frame shift probably null
R0613:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0652:Mroh2a UTSW 1 88230680 nonsense probably null
R0657:Mroh2a UTSW 1 88255565 missense probably damaging 1.00
R0659:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0659:Mroh2a UTSW 1 88250342 missense probably damaging 1.00
R0671:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0675:Mroh2a UTSW 1 88228380 missense probably damaging 0.99
R0675:Mroh2a UTSW 1 88250342 missense probably damaging 1.00
R0689:Mroh2a UTSW 1 88230680 nonsense probably null
R0689:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0735:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0761:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0766:Mroh2a UTSW 1 88230680 nonsense probably null
R0845:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0853:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0959:Mroh2a UTSW 1 88232257 frame shift probably null
R0960:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1004:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1013:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R1028:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R1268:Mroh2a UTSW 1 88230680 nonsense probably null
R1281:Mroh2a UTSW 1 88256167 frame shift probably null
R1414:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R1439:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R1441:Mroh2a UTSW 1 88241631 missense possibly damaging 0.93
R1442:Mroh2a UTSW 1 88232353 splice site probably benign
R1442:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1465:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R1662:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R1686:Mroh2a UTSW 1 88230680 nonsense probably null
R1686:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R1780:Mroh2a UTSW 1 88230680 nonsense probably null
R1846:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R1899:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R1958:Mroh2a UTSW 1 88237491 nonsense probably null
R2122:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R2248:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R2306:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R2869:Mroh2a UTSW 1 88232257 frame shift probably null
R2870:Mroh2a UTSW 1 88232257 frame shift probably null
R2871:Mroh2a UTSW 1 88255565 missense probably damaging 1.00
R2872:Mroh2a UTSW 1 88232257 frame shift probably null
R3408:Mroh2a UTSW 1 88232257 frame shift probably null
R3608:Mroh2a UTSW 1 88244995 missense probably damaging 1.00
R3730:Mroh2a UTSW 1 88232257 frame shift probably null
R3937:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4022:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R4049:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4133:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4361:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4392:Mroh2a UTSW 1 88259589 missense probably damaging 1.00
R4401:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4402:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4575:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4625:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4631:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4665:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R4701:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R4701:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R4771:Mroh2a UTSW 1 88251365 missense probably damaging 1.00
R4795:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4839:Mroh2a UTSW 1 88237944 missense probably damaging 1.00
R4873:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4875:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4896:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R5007:Mroh2a UTSW 1 88232257 frame shift probably null
R5031:Mroh2a UTSW 1 88232257 frame shift probably null
R5062:Mroh2a UTSW 1 88232257 frame shift probably null
R5301:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5367:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R5371:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5446:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R5484:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5561:Mroh2a UTSW 1 88232257 frame shift probably null
R5615:Mroh2a UTSW 1 88232257 frame shift probably null
R5825:Mroh2a UTSW 1 88230680 nonsense probably null
R5891:Mroh2a UTSW 1 88241615 missense possibly damaging 0.93
R5906:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5928:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R6004:Mroh2a UTSW 1 88248655 missense probably damaging 1.00
R6035:Mroh2a UTSW 1 88230668 missense probably damaging 1.00
R6064:Mroh2a UTSW 1 88232257 frame shift probably null
R6074:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R6091:Mroh2a UTSW 1 88232257 frame shift probably null
R6127:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R6234:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R6234:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R6244:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R6464:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R6465:Mroh2a UTSW 1 88232257 frame shift probably null
R6575:Mroh2a UTSW 1 88232257 frame shift probably null
R6809:Mroh2a UTSW 1 88235216 missense probably benign 0.01
R6819:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R6854:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R6860:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R7126:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
V5622:Mroh2a UTSW 1 88227091 start gained probably benign
V8831:Mroh2a UTSW 1 88256167 frame shift probably null
X0027:Mroh2a UTSW 1 88248613 missense possibly damaging 0.86
X0028:Mroh2a UTSW 1 88232257 frame shift probably null
X0028:Mroh2a UTSW 1 88256166 frame shift probably null
X0033:Mroh2a UTSW 1 88256166 frame shift probably null
X0034:Mroh2a UTSW 1 88232257 frame shift probably null
X0034:Mroh2a UTSW 1 88232292 missense probably damaging 1.00
X0034:Mroh2a UTSW 1 88256166 frame shift probably null
X0039:Mroh2a UTSW 1 88232257 frame shift probably null
X0057:Mroh2a UTSW 1 88232257 frame shift probably null
X0057:Mroh2a UTSW 1 88255655 missense probably benign 0.25
X0057:Mroh2a UTSW 1 88256166 frame shift probably null
X0063:Mroh2a UTSW 1 88232257 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGCTGTAGAGCCCTTTCTGG -3'
(R):5'- AGAGCATTCCTTCCTGTCAGGG -3'

Sequencing Primer
(F):5'- TGGGGCTGCTCTCTCTC -3'
(R):5'- ACCTTCCTGGACTTTGAAGATTG -3'
Posted On2017-07-21