Incidental Mutation 'R5493:Zfp26'
ID484499
Institutional Source Beutler Lab
Gene Symbol Zfp26
Ensembl Gene ENSMUSG00000063108
Gene Namezinc finger protein 26
SynonymsZfp70, KRAB15, Zfp81-rs1, Zfp-26, 5033428C05Rik, mkr-3
MMRRC Submission 043054-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5493 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location20428449-20460162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20444319 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 56 (T56A)
Ref Sequence ENSEMBL: ENSMUSP00000123960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159569] [ENSMUST00000162438]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000075263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098970
Predicted Effect probably benign
Transcript: ENSMUST00000159569
AA Change: T56A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124075
Gene: ENSMUSG00000063108
AA Change: T56A

DomainStartEndE-ValueType
Blast:KRAB 40 93 3e-6 BLAST
KRAB 107 167 4.28e-32 SMART
ZnF_C2H2 289 311 3.34e-2 SMART
ZnF_C2H2 344 366 3.63e-3 SMART
ZnF_C2H2 372 394 4.54e-4 SMART
ZnF_C2H2 400 422 2.65e-5 SMART
ZnF_C2H2 428 450 1.12e-3 SMART
ZnF_C2H2 456 478 9.08e-4 SMART
ZnF_C2H2 484 506 7.9e-4 SMART
ZnF_C2H2 512 534 2.43e-4 SMART
ZnF_C2H2 540 562 1.36e-2 SMART
ZnF_C2H2 568 590 3.44e-4 SMART
ZnF_C2H2 596 618 6.52e-5 SMART
ZnF_C2H2 624 646 2.32e-1 SMART
ZnF_C2H2 652 674 9.22e-5 SMART
ZnF_C2H2 680 702 1.22e-4 SMART
ZnF_C2H2 708 730 4.87e-4 SMART
ZnF_C2H2 736 758 4.54e-4 SMART
ZnF_C2H2 764 786 3.44e-4 SMART
ZnF_C2H2 792 814 5.21e-4 SMART
ZnF_C2H2 820 842 3.44e-4 SMART
ZnF_C2H2 848 870 5.14e-3 SMART
ZnF_C2H2 876 898 2.79e-4 SMART
ZnF_C2H2 904 926 2.12e-4 SMART
ZnF_C2H2 932 954 9.56e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161248
Predicted Effect possibly damaging
Transcript: ENSMUST00000162438
AA Change: T56A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180846
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the krueppel C2H2-type zinc-finger protein family, and it contains one KRAB domain and eighteen C2H2-type zinc fingers. This gene is a candidate gene for autism and variable cognitive impairment in the 16q24.3 microdeletion syndrome. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik A G 16: 21,653,243 S236P possibly damaging Het
A830018L16Rik C T 1: 11,545,207 R135C probably damaging Het
Agpat3 A G 10: 78,284,235 V155A possibly damaging Het
Aldh18a1 C T 19: 40,551,290 R747Q probably damaging Het
Aloxe3 A T 11: 69,128,617 R119* probably null Het
Asap1 A G 15: 64,130,151 V460A possibly damaging Het
Bicral C A 17: 46,801,694 R860L possibly damaging Het
Cd180 T A 13: 102,706,141 I565N probably benign Het
Cdk13 T C 13: 17,803,562 probably benign Het
Cdkn2d T C 9: 21,289,007 D156G probably benign Het
Clrn1 A G 3: 58,846,416 S175P probably damaging Het
Coro7 A G 16: 4,632,487 L535S probably damaging Het
Cse1l A G 2: 166,941,190 probably benign Het
Cyp2a12 T C 7: 27,029,125 L7P unknown Het
D130043K22Rik A G 13: 24,863,603 Y377C probably damaging Het
Dctn1 G T 6: 83,182,564 R8L possibly damaging Het
Duox2 T C 2: 122,281,496 Q1341R probably damaging Het
Eif2b3 A G 4: 117,086,722 D447G possibly damaging Het
Fbxw25 T C 9: 109,652,916 Y234C probably benign Het
Gcnt2 A G 13: 40,953,600 N315S possibly damaging Het
Gm20730 A T 6: 43,081,812 V22E possibly damaging Het
Gm4847 T A 1: 166,630,321 I488F probably damaging Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gmds A T 13: 31,940,505 M290K probably benign Het
Gtf3c1 T C 7: 125,670,544 N699S probably damaging Het
Hk3 A G 13: 55,011,171 V479A probably damaging Het
Ifnlr1 G A 4: 135,705,566 V438M probably benign Het
Il12rb1 C A 8: 70,809,839 P26T probably benign Het
Il4i1 G T 7: 44,840,053 R414L possibly damaging Het
Ipo4 T C 14: 55,630,870 N490S probably benign Het
Kcnmb2 A G 3: 32,198,142 E164G probably damaging Het
Kcns1 G A 2: 164,167,979 L287F probably benign Het
Kdm1a ACC AC 4: 136,557,421 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Knl1 T A 2: 119,068,730 I304K probably damaging Het
Ksr2 G T 5: 117,708,110 V681F probably damaging Het
Lypd2 T C 15: 74,734,278 T4A probably benign Het
Man1a A G 10: 54,074,480 V182A probably benign Het
Olfr1364 A T 13: 21,573,872 C195S probably damaging Het
Olfr504 T C 7: 108,565,567 D76G probably benign Het
Olfr533 A T 7: 140,466,807 D202V probably damaging Het
Olfr561 A T 7: 102,775,108 R195W probably benign Het
Olfr70 A G 4: 43,696,225 F316S possibly damaging Het
Pcdha2 C A 18: 36,939,509 F64L probably damaging Het
Pgap3 G C 11: 98,390,714 F168L possibly damaging Het
Pip5k1b T C 19: 24,439,075 N16S probably benign Het
Ppip5k1 T A 2: 121,336,772 H41L probably damaging Het
Ppp1r9a A G 6: 5,159,702 R1080G probably damaging Het
Qrich2 A C 11: 116,445,948 probably null Het
Rbl2 C T 8: 91,115,819 P1034L probably damaging Het
Rbpjl GCC GC 2: 164,414,410 probably null Het
Rin2 A G 2: 145,860,709 S442G probably damaging Het
Rtca C T 3: 116,499,631 R71Q probably benign Het
Serpind1 A T 16: 17,340,038 N366I probably damaging Het
Shox2 C G 3: 66,981,463 G32R probably damaging Het
Sp3 T A 2: 72,938,122 N766Y probably damaging Het
Spag7 T A 11: 70,669,233 S17C probably null Het
Stk25 A T 1: 93,635,309 F7I probably benign Het
Tbx15 G A 3: 99,352,564 G584S probably benign Het
Tenm2 T C 11: 36,864,676 D165G probably benign Het
Tox2 C A 2: 163,204,729 S42* probably null Het
Vmn1r39 A G 6: 66,804,770 V188A probably damaging Het
Zbtb5 A T 4: 44,993,941 M481K probably benign Het
Zfp459 C A 13: 67,408,379 C195F probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp764 A G 7: 127,404,933 I342T probably benign Het
Zfp942 T C 17: 21,933,004 N7D probably null Het
Other mutations in Zfp26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Zfp26 APN 9 20439548 missense possibly damaging 0.68
IGL02273:Zfp26 APN 9 20441448 missense probably damaging 0.96
FR4449:Zfp26 UTSW 9 20438546 missense probably benign 0.01
FR4548:Zfp26 UTSW 9 20438546 missense probably benign 0.01
FR4737:Zfp26 UTSW 9 20438546 missense probably benign 0.01
FR4976:Zfp26 UTSW 9 20438546 missense probably benign 0.01
LCD18:Zfp26 UTSW 9 20438546 missense probably benign 0.01
R0157:Zfp26 UTSW 9 20437870 missense probably benign 0.37
R1591:Zfp26 UTSW 9 20437625 missense probably benign 0.01
R1818:Zfp26 UTSW 9 20442191 missense probably benign 0.00
R1936:Zfp26 UTSW 9 20437553 missense probably benign 0.04
R2081:Zfp26 UTSW 9 20436617 missense probably benign 0.17
R2107:Zfp26 UTSW 9 20442237 missense probably benign
R2240:Zfp26 UTSW 9 20437267 missense probably damaging 1.00
R3429:Zfp26 UTSW 9 20441460 unclassified probably benign
R3785:Zfp26 UTSW 9 20437802 missense probably damaging 1.00
R4050:Zfp26 UTSW 9 20442229 missense probably benign
R4198:Zfp26 UTSW 9 20436716 missense probably benign 0.17
R4200:Zfp26 UTSW 9 20436716 missense probably benign 0.17
R4360:Zfp26 UTSW 9 20438573 missense probably benign 0.35
R4505:Zfp26 UTSW 9 20442265 missense probably benign 0.29
R5171:Zfp26 UTSW 9 20444907 missense probably benign
R5412:Zfp26 UTSW 9 20438239 missense possibly damaging 0.75
R5576:Zfp26 UTSW 9 20437507 missense possibly damaging 0.86
R5652:Zfp26 UTSW 9 20437841 nonsense probably null
R6089:Zfp26 UTSW 9 20437693 missense probably damaging 0.99
R6332:Zfp26 UTSW 9 20437286 missense probably damaging 1.00
X0065:Zfp26 UTSW 9 20436891 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAAGTTTGATGTAGATGCCCC -3'
(R):5'- GTCCCAAGAGACTATGGGAGAC -3'

Sequencing Primer
(F):5'- GATGTAGATGCCCCCTGAATTAAAC -3'
(R):5'- GGAGACCTCACGCTCTCTCTAG -3'
Posted On2017-07-24