Incidental Mutation 'R5444:Nfatc2'
ID484508
Institutional Source Beutler Lab
Gene Symbol Nfatc2
Ensembl Gene ENSMUSG00000027544
Gene Namenuclear factor of activated T cells, cytoplasmic, calcineurin dependent 2
SynonymsNFAT1-D, NFATp, NFAT1
MMRRC Submission 043009-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5444 (G1)
Quality Score79
Status Validated
Chromosome2
Chromosomal Location168476410-168601657 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 168534890 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029057] [ENSMUST00000074618] [ENSMUST00000109184] [ENSMUST00000137451] [ENSMUST00000171689]
Predicted Effect probably benign
Transcript: ENSMUST00000029057
SMART Domains Protein: ENSMUSP00000029057
Gene: ENSMUSG00000027544

DomainStartEndE-ValueType
low complexity region 4 22 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 170 187 N/A INTRINSIC
low complexity region 236 255 N/A INTRINSIC
low complexity region 267 283 N/A INTRINSIC
Pfam:RHD 412 572 2.6e-24 PFAM
Blast:IPT 579 618 8e-19 BLAST
SCOP:d1imhc1 579 619 3e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074618
SMART Domains Protein: ENSMUSP00000074198
Gene: ENSMUSG00000027544

DomainStartEndE-ValueType
low complexity region 4 22 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 170 187 N/A INTRINSIC
low complexity region 236 255 N/A INTRINSIC
low complexity region 267 283 N/A INTRINSIC
Pfam:RHD_DNA_bind 412 572 2.8e-24 PFAM
IPT 579 678 1.65e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000099067
Predicted Effect probably benign
Transcript: ENSMUST00000109184
SMART Domains Protein: ENSMUSP00000104812
Gene: ENSMUSG00000027544

DomainStartEndE-ValueType
low complexity region 4 22 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 170 187 N/A INTRINSIC
low complexity region 236 255 N/A INTRINSIC
low complexity region 267 283 N/A INTRINSIC
Pfam:RHD 412 572 1.3e-24 PFAM
IPT 579 678 1.65e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137451
SMART Domains Protein: ENSMUSP00000118329
Gene: ENSMUSG00000027544

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 167 N/A INTRINSIC
low complexity region 216 235 N/A INTRINSIC
low complexity region 247 263 N/A INTRINSIC
Pfam:RHD 392 552 7.9e-25 PFAM
Blast:IPT 559 598 8e-19 BLAST
SCOP:d1imhc1 559 599 2e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140137
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151292
Predicted Effect probably benign
Transcript: ENSMUST00000171689
SMART Domains Protein: ENSMUSP00000130875
Gene: ENSMUSG00000027544

DomainStartEndE-ValueType
low complexity region 15 34 N/A INTRINSIC
low complexity region 46 62 N/A INTRINSIC
Pfam:RHD 191 351 1.3e-24 PFAM
Blast:IPT 358 397 4e-19 BLAST
SCOP:d1imhc1 358 398 1e-9 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nuclear factor of activated T cells (NFAT) family. The product of this gene is a DNA-binding protein with a REL-homology region (RHR) and an NFAT-homology region (NHR). This protein is present in the cytosol and only translocates to the nucleus upon T cell receptor (TCR) stimulation, where it becomes a member of the nuclear factors of activated T cells transcription complex. This complex plays a central role in inducing gene transcription during the immune response. Alternate transcriptional splice variants encoding different isoforms have been characterized. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mutations in this locus cause altered immune system function such as decreased cytokine production by mast cells, increased Th2 responses after infection with a parasite but decreased Th1 responses after myobacterial infection, retarded thymic involutionand massive germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,726,384 T826I possibly damaging Het
4930584F24Rik A G 5: 26,479,737 noncoding transcript Het
5430403G16Rik A T 5: 109,675,636 Y649* probably null Het
Adam11 A G 11: 102,772,848 Q284R probably damaging Het
Adamts17 T A 7: 67,041,899 H610Q probably benign Het
Alg6 A G 4: 99,741,579 Y131C probably benign Het
Apol9b T C 15: 77,735,763 I253T probably damaging Het
Asb4 T A 6: 5,431,040 I425N probably damaging Het
Atic T C 1: 71,576,717 L474P probably damaging Het
B3glct C T 5: 149,746,520 T318I probably damaging Het
Bbs7 T C 3: 36,612,050 K22E possibly damaging Het
BC037034 A T 5: 138,260,998 probably null Het
Cdk17 T G 10: 93,217,961 probably null Het
Cemip T A 7: 83,982,291 T438S probably damaging Het
Chd2 T C 7: 73,473,085 E967G probably damaging Het
Cyp2d26 G T 15: 82,792,538 D202E probably benign Het
Dhdds G A 4: 133,971,136 R295* probably null Het
Eef2kmt G A 16: 5,249,095 probably benign Het
Fn3krp G A 11: 121,421,604 probably null Het
Gjc3 G A 5: 137,957,547 L159F probably damaging Het
Gm28434 T C 5: 87,979,288 probably benign Het
Gp2 G A 7: 119,454,598 P47S possibly damaging Het
Irf7 C T 7: 141,264,819 probably benign Het
Itgb8 T C 12: 119,237,838 probably benign Het
Kcnb2 A T 1: 15,711,492 I863F probably benign Het
Lamb1 T C 12: 31,298,909 F647L possibly damaging Het
Mccc1 T A 3: 35,976,742 M392L probably benign Het
Mtmr10 T C 7: 64,288,401 probably null Het
Ncstn A C 1: 172,072,839 V223G possibly damaging Het
Neurl3 G T 1: 36,269,490 F80L probably damaging Het
Nf1 T C 11: 79,443,959 M869T possibly damaging Het
Nnat T C 2: 157,561,217 F26S possibly damaging Het
Nos1ap T C 1: 170,375,251 Y109C probably damaging Het
Nup205 T A 6: 35,189,189 D194E probably damaging Het
Olfr1012 A T 2: 85,759,919 F152L probably benign Het
Olfr1333 T A 4: 118,830,111 I109L probably benign Het
Olfr1463 A T 19: 13,234,958 Q236L probably benign Het
Olfr399 T C 11: 74,053,977 S261G probably benign Het
Olfr552 C T 7: 102,604,869 R172* probably null Het
Ostf1 A G 19: 18,581,313 L202S probably benign Het
Pdzrn4 T A 15: 92,770,925 M747K probably damaging Het
Plxnb1 A G 9: 109,106,453 D1019G probably benign Het
Pnlip A G 19: 58,673,163 I95V probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ppp1r13b T A 12: 111,838,688 T197S probably benign Het
Rasgrp3 A T 17: 75,503,375 I357F probably damaging Het
Rbmxl2 G C 7: 107,209,837 G110R probably damaging Het
Rgs22 T C 15: 36,015,627 D1037G possibly damaging Het
Rnf215 A G 11: 4,135,843 I107M probably benign Het
Rybp A T 6: 100,287,270 M3K probably damaging Het
Sgo2b T C 8: 63,926,556 S1081G possibly damaging Het
Slfn10-ps C T 11: 83,035,287 noncoding transcript Het
Spag17 T C 3: 100,056,152 V1062A probably benign Het
Sult2a1 A T 7: 13,836,019 I96K possibly damaging Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Thbs3 T C 3: 89,223,385 probably benign Het
Tmub2 T C 11: 102,288,240 L255S possibly damaging Het
Trank1 T A 9: 111,392,958 L2921Q probably benign Het
Tuba8 A T 6: 121,226,101 probably benign Het
Vmn2r25 T C 6: 123,828,492 I469V probably benign Het
Other mutations in Nfatc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Nfatc2 APN 2 168504890 missense probably damaging 1.00
IGL01728:Nfatc2 APN 2 168536242 missense probably damaging 1.00
IGL02303:Nfatc2 APN 2 168506901 nonsense probably null
IGL02887:Nfatc2 APN 2 168504450 missense probably damaging 1.00
IGL03002:Nfatc2 APN 2 168534984 missense probably damaging 1.00
IGL03297:Nfatc2 APN 2 168536218 missense probably damaging 0.99
R0347:Nfatc2 UTSW 2 168536290 missense probably damaging 1.00
R0590:Nfatc2 UTSW 2 168571199 missense probably damaging 0.99
R0631:Nfatc2 UTSW 2 168590115 missense probably benign 0.02
R1019:Nfatc2 UTSW 2 168504879 missense probably damaging 1.00
R1183:Nfatc2 UTSW 2 168590088 missense possibly damaging 0.83
R1420:Nfatc2 UTSW 2 168504665 missense probably benign 0.01
R1977:Nfatc2 UTSW 2 168504459 missense possibly damaging 0.68
R2306:Nfatc2 UTSW 2 168590103 missense probably damaging 1.00
R3034:Nfatc2 UTSW 2 168535020 missense probably damaging 1.00
R3176:Nfatc2 UTSW 2 168506994 missense possibly damaging 0.51
R3276:Nfatc2 UTSW 2 168506994 missense possibly damaging 0.51
R3964:Nfatc2 UTSW 2 168504549 missense probably benign 0.00
R3966:Nfatc2 UTSW 2 168504549 missense probably benign 0.00
R4669:Nfatc2 UTSW 2 168571490 missense probably benign
R4864:Nfatc2 UTSW 2 168536392 missense probably damaging 0.96
R4951:Nfatc2 UTSW 2 168571072 missense probably damaging 0.98
R5138:Nfatc2 UTSW 2 168536309 missense probably damaging 1.00
R5145:Nfatc2 UTSW 2 168590067 missense probably benign 0.25
R5185:Nfatc2 UTSW 2 168570707 missense possibly damaging 0.48
R5496:Nfatc2 UTSW 2 168536278 missense probably damaging 1.00
R5728:Nfatc2 UTSW 2 168480249 missense probably benign
R5791:Nfatc2 UTSW 2 168536393 missense probably benign 0.28
R6102:Nfatc2 UTSW 2 168519507 intron probably benign
R6157:Nfatc2 UTSW 2 168519451 intron probably benign
R6187:Nfatc2 UTSW 2 168480238 missense probably benign 0.13
R7116:Nfatc2 UTSW 2 168507349 missense probably benign 0.04
R7218:Nfatc2 UTSW 2 168571264 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCAAATGTGTCACACTTCTG -3'
(R):5'- GAAACGCTGACATCGAGCTG -3'

Sequencing Primer
(F):5'- ATGTGTCACACTTCTGAAGACC -3'
(R):5'- CTGACATCGAGCTGCGGAAG -3'
Posted On2017-08-01