Incidental Mutation 'R5444:Rbmxl2'
ID484510
Institutional Source Beutler Lab
Gene Symbol Rbmxl2
Ensembl Gene ENSMUSG00000073894
Gene NameRNA binding motif protein, X-linked-like 2
Synonyms1700012H05Rik
MMRRC Submission 043009-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R5444 (G1)
Quality Score28
Status Validated
Chromosome7
Chromosomal Location107209445-107210916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 107209837 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 110 (G110R)
Ref Sequence ENSEMBL: ENSMUSP00000095739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098135]
Predicted Effect probably damaging
Transcript: ENSMUST00000098135
AA Change: G110R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095739
Gene: ENSMUSG00000073894
AA Change: G110R

DomainStartEndE-ValueType
RRM 9 82 1.12e-26 SMART
low complexity region 91 125 N/A INTRINSIC
Pfam:RBM1CTR 169 214 9.9e-21 PFAM
Blast:RRM 219 250 5e-11 BLAST
low complexity region 285 307 N/A INTRINSIC
low complexity region 316 337 N/A INTRINSIC
low complexity region 358 384 N/A INTRINSIC
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the HNRPG subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two RRM domains that bind RNAs. This gene is intronless and is thought to be derived from a processed retroposon. However, unlike many retroposon-derived genes, this gene is not a pseudogene. The encoded protein has similarity to HNRPG and RBMY proteins and it is suggested to replace HNRPG protein function during meiotic prophase or act as a germ cell-specific splicing regulator. It primarily localizes to the nuclei of meiotic spermatocytes. This gene is a candidate for autosomal male infertility. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,726,384 T826I possibly damaging Het
4930584F24Rik A G 5: 26,479,737 noncoding transcript Het
5430403G16Rik A T 5: 109,675,636 Y649* probably null Het
Adam11 A G 11: 102,772,848 Q284R probably damaging Het
Adamts17 T A 7: 67,041,899 H610Q probably benign Het
Alg6 A G 4: 99,741,579 Y131C probably benign Het
Apol9b T C 15: 77,735,763 I253T probably damaging Het
Asb4 T A 6: 5,431,040 I425N probably damaging Het
Atic T C 1: 71,576,717 L474P probably damaging Het
B3glct C T 5: 149,746,520 T318I probably damaging Het
Bbs7 T C 3: 36,612,050 K22E possibly damaging Het
BC037034 A T 5: 138,260,998 probably null Het
Cdk17 T G 10: 93,217,961 probably null Het
Cemip T A 7: 83,982,291 T438S probably damaging Het
Chd2 T C 7: 73,473,085 E967G probably damaging Het
Cyp2d26 G T 15: 82,792,538 D202E probably benign Het
Dhdds G A 4: 133,971,136 R295* probably null Het
Eef2kmt G A 16: 5,249,095 probably benign Het
Fn3krp G A 11: 121,421,604 probably null Het
Gjc3 G A 5: 137,957,547 L159F probably damaging Het
Gm28434 T C 5: 87,979,288 probably benign Het
Gp2 G A 7: 119,454,598 P47S possibly damaging Het
Irf7 C T 7: 141,264,819 probably benign Het
Itgb8 T C 12: 119,237,838 probably benign Het
Kcnb2 A T 1: 15,711,492 I863F probably benign Het
Lamb1 T C 12: 31,298,909 F647L possibly damaging Het
Mccc1 T A 3: 35,976,742 M392L probably benign Het
Mtmr10 T C 7: 64,288,401 probably null Het
Ncstn A C 1: 172,072,839 V223G possibly damaging Het
Neurl3 G T 1: 36,269,490 F80L probably damaging Het
Nf1 T C 11: 79,443,959 M869T possibly damaging Het
Nfatc2 A G 2: 168,534,890 probably benign Het
Nnat T C 2: 157,561,217 F26S possibly damaging Het
Nos1ap T C 1: 170,375,251 Y109C probably damaging Het
Nup205 T A 6: 35,189,189 D194E probably damaging Het
Olfr1012 A T 2: 85,759,919 F152L probably benign Het
Olfr1333 T A 4: 118,830,111 I109L probably benign Het
Olfr1463 A T 19: 13,234,958 Q236L probably benign Het
Olfr399 T C 11: 74,053,977 S261G probably benign Het
Olfr552 C T 7: 102,604,869 R172* probably null Het
Ostf1 A G 19: 18,581,313 L202S probably benign Het
Pdzrn4 T A 15: 92,770,925 M747K probably damaging Het
Plxnb1 A G 9: 109,106,453 D1019G probably benign Het
Pnlip A G 19: 58,673,163 I95V probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ppp1r13b T A 12: 111,838,688 T197S probably benign Het
Rasgrp3 A T 17: 75,503,375 I357F probably damaging Het
Rgs22 T C 15: 36,015,627 D1037G possibly damaging Het
Rnf215 A G 11: 4,135,843 I107M probably benign Het
Rybp A T 6: 100,287,270 M3K probably damaging Het
Sgo2b T C 8: 63,926,556 S1081G possibly damaging Het
Slfn10-ps C T 11: 83,035,287 noncoding transcript Het
Spag17 T C 3: 100,056,152 V1062A probably benign Het
Sult2a1 A T 7: 13,836,019 I96K possibly damaging Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Thbs3 T C 3: 89,223,385 probably benign Het
Tmub2 T C 11: 102,288,240 L255S possibly damaging Het
Trank1 T A 9: 111,392,958 L2921Q probably benign Het
Tuba8 A T 6: 121,226,101 probably benign Het
Vmn2r25 T C 6: 123,828,492 I469V probably benign Het
Other mutations in Rbmxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03147:Rbmxl2 UTSW 7 107209651 missense probably benign 0.00
R1958:Rbmxl2 UTSW 7 107210198 missense probably benign 0.06
R2435:Rbmxl2 UTSW 7 107210331 missense probably damaging 1.00
R3107:Rbmxl2 UTSW 7 107210417 missense probably damaging 0.98
R5020:Rbmxl2 UTSW 7 107210207 missense probably damaging 1.00
R5243:Rbmxl2 UTSW 7 107209837 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCGTCACCTTCGAGAACCC -3'
(R):5'- CATAGTCGCGGTAGGTGTAGTC -3'

Sequencing Primer
(F):5'- TTCGAGAACCCCGCGGAC -3'
(R):5'- TCGAATAGCTCTCCCGGG -3'
Posted On2017-08-01