Incidental Mutation 'R5504:Pxdn'
ID484519
Institutional Source Beutler Lab
Gene Symbol Pxdn
Ensembl Gene ENSMUSG00000020674
Gene Nameperoxidasin
SynonymsVPO1, 2310075M15Rik
MMRRC Submission 043065-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.545) question?
Stock #R5504 (G1)
Quality Score50
Status Validated
Chromosome12
Chromosomal Location29937608-30017658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 30002801 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 812 (H812Q)
Ref Sequence ENSEMBL: ENSMUSP00000151320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122328] [ENSMUST00000220271]
Predicted Effect probably damaging
Transcript: ENSMUST00000122328
AA Change: H992Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113703
Gene: ENSMUSG00000020674
AA Change: H992Q

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LRRNT 32 63 2.52e-1 SMART
LRR 62 81 4.09e1 SMART
LRR_TYP 82 105 3.69e-4 SMART
LRR_TYP 106 129 1.45e-2 SMART
LRR_TYP 130 153 8.02e-5 SMART
LRR_TYP 154 177 1.06e-4 SMART
LRRCT 189 241 3.97e-5 SMART
IGc2 255 321 1.59e-15 SMART
IGc2 351 416 3.96e-16 SMART
IGc2 442 506 2.96e-15 SMART
IGc2 534 598 1.2e-15 SMART
Pfam:An_peroxidase 738 1286 1.1e-196 PFAM
VWC 1411 1466 8.8e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218620
Predicted Effect probably damaging
Transcript: ENSMUST00000220271
AA Change: H812Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.596 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heme-containing peroxidase that is secreted into the extracellular matrix. It is involved in extracellular matrix formation, and may function in the physiological and pathological fibrogenic response in fibrotic kidney. Mutations in this gene cause corneal opacification and other ocular anomalies, and also microphthalmia and anterior segment dysgenesis. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal eye development with early-onset glaucoma and progressive retinal dysgenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1b7 A G 6: 34,419,518 probably null Het
Amy2a1 T G 3: 113,531,669 D92A probably benign Het
Angel2 A G 1: 190,943,886 T455A probably damaging Het
Angptl2 T C 2: 33,229,038 probably benign Het
Ankrd40 A G 11: 94,328,327 E25G probably benign Het
Asb18 T A 1: 89,993,024 D136V probably damaging Het
Asphd1 T C 7: 126,946,178 I336V possibly damaging Het
Birc6 C T 17: 74,655,213 P58S probably damaging Het
Bsx A T 9: 40,874,164 probably benign Het
Cabin1 A G 10: 75,653,009 L1965P probably benign Het
Capza3 A T 6: 140,042,439 I255L probably benign Het
Ccdc185 G T 1: 182,747,627 A499E probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Colgalt2 G A 1: 152,400,303 V56M possibly damaging Het
Dennd1b A T 1: 139,090,508 T197S probably benign Het
Dhx30 A G 9: 110,085,210 Y1000H probably benign Het
Dlg2 C T 7: 92,442,657 A910V probably damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dock5 T C 14: 67,803,086 D884G probably benign Het
Fhad1 A G 4: 141,985,535 S198P probably benign Het
Gabpa T C 16: 84,852,558 S218P probably benign Het
Gm17654 A T 14: 43,578,037 N104K unknown Het
Gm1966 T A 7: 106,602,744 noncoding transcript Het
Gm4775 T C 14: 106,100,955 noncoding transcript Het
Gm4788 A T 1: 139,701,820 S749T probably benign Het
Gm5346 C T 8: 43,625,282 C635Y probably damaging Het
Heatr1 T A 13: 12,406,619 S467T possibly damaging Het
Hecw1 A G 13: 14,340,902 M215T probably benign Het
Hmgn2 A T 4: 133,966,803 probably benign Het
Kncn T A 4: 115,884,865 I43N possibly damaging Het
Lgals3bp G T 11: 118,393,985 T256N probably benign Het
Mpi T C 9: 57,545,217 D344G probably damaging Het
Myom2 G A 8: 15,128,879 E1304K probably damaging Het
Npat T A 9: 53,570,264 F1091I probably benign Het
Nrcam T G 12: 44,564,132 probably null Het
Olfr1219 C T 2: 89,074,680 R137Q probably benign Het
Olfr13 T A 6: 43,174,638 Y217* probably null Het
Olfr684 T C 7: 105,157,176 K169E probably benign Het
Pappa2 A G 1: 158,848,045 S1044P probably benign Het
Pcnx4 T C 12: 72,574,448 L1014S probably damaging Het
Pear1 G A 3: 87,752,695 probably benign Het
Piwil2 T A 14: 70,389,899 Y797F probably benign Het
Ppp2r1b T G 9: 50,858,887 L81R probably damaging Het
Rad21l A T 2: 151,668,437 F33I probably damaging Het
Rgs13 A T 1: 144,139,620 C120S possibly damaging Het
Rp1 G A 1: 4,349,890 T333M probably damaging Het
Sema6d T A 2: 124,658,021 V339E probably damaging Het
Serpina3i T A 12: 104,266,603 Y256N probably damaging Het
Slc13a1 A T 6: 24,150,744 M65K possibly damaging Het
Slco6d1 A G 1: 98,421,339 K45R probably damaging Het
Src T C 2: 157,464,721 Y215H probably damaging Het
Synj2 T C 17: 6,036,475 V384A possibly damaging Het
Tmeff1 T C 4: 48,650,396 S285P probably damaging Het
Vmn2r125 A G 4: 156,351,161 D278G possibly damaging Het
Vmn2r45 T C 7: 8,483,177 K371E probably benign Het
Zfp866 A T 8: 69,765,691 H426Q probably benign Het
Other mutations in Pxdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Pxdn APN 12 29987099 missense probably damaging 1.00
IGL01152:Pxdn APN 12 30001937 missense probably damaging 0.99
IGL01286:Pxdn APN 12 29982754 missense probably benign 0.04
IGL01323:Pxdn APN 12 29987137 missense probably benign 0.00
IGL01338:Pxdn APN 12 30002797 missense probably damaging 1.00
IGL01341:Pxdn APN 12 30002487 missense probably damaging 1.00
IGL01401:Pxdn APN 12 30001984 missense probably damaging 1.00
IGL01580:Pxdn APN 12 29984493 missense probably benign 0.18
IGL01650:Pxdn APN 12 30002401 missense probably benign 0.01
IGL01679:Pxdn APN 12 29999902 missense probably damaging 0.97
IGL01866:Pxdn APN 12 29984571 missense probably benign 0.02
IGL02354:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02361:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02427:Pxdn APN 12 29984532 missense probably damaging 1.00
IGL02955:Pxdn APN 12 30003157 missense probably damaging 1.00
IGL03079:Pxdn APN 12 30002998 missense probably damaging 0.97
IGL03111:Pxdn APN 12 29982756 missense probably damaging 0.99
IGL02988:Pxdn UTSW 12 30003114 nonsense probably null
PIT4280001:Pxdn UTSW 12 29995328 missense probably damaging 0.99
PIT4469001:Pxdn UTSW 12 30005829 missense probably benign 0.00
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0086:Pxdn UTSW 12 30002419 missense possibly damaging 0.95
R0140:Pxdn UTSW 12 29982754 missense probably benign 0.04
R0201:Pxdn UTSW 12 30002431 missense possibly damaging 0.79
R0282:Pxdn UTSW 12 29984440 nonsense probably null
R0310:Pxdn UTSW 12 30015529 missense probably damaging 1.00
R0426:Pxdn UTSW 12 29987066 missense possibly damaging 0.89
R0468:Pxdn UTSW 12 29994486 missense probably damaging 0.99
R0825:Pxdn UTSW 12 29984996 splice site probably benign
R0885:Pxdn UTSW 12 30003402 missense probably benign 0.30
R1420:Pxdn UTSW 12 30002068 missense probably damaging 1.00
R1588:Pxdn UTSW 12 30002559 missense probably damaging 1.00
R2269:Pxdn UTSW 12 30005775 missense probably damaging 0.97
R2280:Pxdn UTSW 12 29984906 missense probably damaging 0.98
R2504:Pxdn UTSW 12 30003406 missense probably damaging 1.00
R2679:Pxdn UTSW 12 29975569 splice site probably benign
R3116:Pxdn UTSW 12 30002307 missense possibly damaging 0.89
R3607:Pxdn UTSW 12 29990918 missense probably benign 0.04
R4033:Pxdn UTSW 12 30003225 missense probably benign 0.19
R4576:Pxdn UTSW 12 30011923 missense probably benign
R4659:Pxdn UTSW 12 29994553 missense probably benign 0.01
R4681:Pxdn UTSW 12 30012326 missense probably benign 0.45
R4968:Pxdn UTSW 12 30000012 missense probably benign 0.25
R5032:Pxdn UTSW 12 30003141 missense probably benign 0.08
R5232:Pxdn UTSW 12 29990988 missense probably benign 0.08
R5366:Pxdn UTSW 12 30002900 missense probably damaging 1.00
R5586:Pxdn UTSW 12 30003142 missense probably damaging 0.99
R5739:Pxdn UTSW 12 29982334 missense probably benign 0.03
R5877:Pxdn UTSW 12 30003046 missense probably damaging 1.00
R6167:Pxdn UTSW 12 29974001 missense probably damaging 1.00
R6191:Pxdn UTSW 12 29982717 missense possibly damaging 0.94
R6200:Pxdn UTSW 12 30003112 missense probably damaging 1.00
R6609:Pxdn UTSW 12 30002941 missense probably benign 0.00
R6628:Pxdn UTSW 12 29999918 missense probably damaging 1.00
R6865:Pxdn UTSW 12 30014583 splice site probably null
R6921:Pxdn UTSW 12 30015505 missense probably damaging 0.96
R6995:Pxdn UTSW 12 29995371 missense possibly damaging 0.95
R7211:Pxdn UTSW 12 29984904 missense possibly damaging 0.77
R7220:Pxdn UTSW 12 29994480 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTGTGCAGAGGTCTGGCAAG -3'
(R):5'- CAGAGTGTGACCGAACCTGAAG -3'

Sequencing Primer
(F):5'- AGGTCTGGCAAGCCCCTG -3'
(R):5'- AGATGCCAGCATTGACACTG -3'
Posted On2017-08-08