Incidental Mutation 'R0520:Olfr871'
ID48459
Institutional Source Beutler Lab
Gene Symbol Olfr871
Ensembl Gene ENSMUSG00000061457
Gene Nameolfactory receptor 871
SynonymsGA_x6K02T2PVTD-13952555-13953490, MOR141-2
MMRRC Submission 038713-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R0520 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location20212207-20213353 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 20212495 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 49 (V49I)
Ref Sequence ENSEMBL: ENSMUSP00000072865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073122]
Predicted Effect probably benign
Transcript: ENSMUST00000073122
AA Change: V49I

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000072865
Gene: ENSMUSG00000061457
AA Change: V49I

DomainStartEndE-ValueType
Pfam:7tm_4 31 311 8.3e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 304 2.1e-7 PFAM
Pfam:7tm_1 41 290 9.1e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158891
Meta Mutation Damage Score 0.1416 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010005H15Rik A G 16: 36,253,091 I16V probably benign Het
Acod1 T C 14: 103,051,516 I154T possibly damaging Het
Acr G T 15: 89,573,227 C226F probably damaging Het
Aff1 C T 5: 103,847,751 R1070* probably null Het
Aldh9a1 C T 1: 167,361,391 probably benign Het
Apaf1 A T 10: 91,079,989 H12Q probably damaging Het
Asic1 A T 15: 99,695,535 I291F probably damaging Het
Aspm T A 1: 139,478,820 M1815K possibly damaging Het
Asxl3 A T 18: 22,522,986 D1351V probably damaging Het
Atg9a C T 1: 75,186,534 W299* probably null Het
B3gntl1 C A 11: 121,623,488 V313F possibly damaging Het
B4galnt4 T A 7: 141,067,373 C345* probably null Het
Bicc1 A T 10: 70,957,190 F211L probably damaging Het
Cachd1 T G 4: 100,897,703 V117G probably damaging Het
Cdc16 G A 8: 13,760,569 probably null Het
Cers6 C T 2: 69,105,091 Q312* probably null Het
Dclre1c A G 2: 3,436,475 H115R probably damaging Het
Ddx20 T C 3: 105,687,376 T18A probably benign Het
Dhx57 A G 17: 80,258,175 V816A possibly damaging Het
Dlgap1 C T 17: 70,516,994 Q325* probably null Het
Dnaja1 A T 4: 40,728,072 M178L probably benign Het
Ecd A T 14: 20,328,664 S454T probably benign Het
Efcab6 G A 15: 83,950,046 H454Y probably benign Het
Exo1 T A 1: 175,899,465 D447E probably benign Het
F5 T G 1: 164,209,587 I1965S probably benign Het
Fbn2 A G 18: 58,013,749 C2692R probably damaging Het
Fggy T A 4: 95,601,103 L152Q probably damaging Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Gm9871 A G 6: 101,801,579 noncoding transcript Het
Gnai2 A T 9: 107,620,173 D7E probably benign Het
Gon7 C T 12: 102,757,788 probably benign Het
H2-K1 A T 17: 33,997,416 V272E probably damaging Het
Hectd4 G T 5: 121,331,707 R2555L possibly damaging Het
Hexb T C 13: 97,181,110 R360G probably benign Het
Igsf9b C A 9: 27,323,250 S470R probably benign Het
Inpp5d T C 1: 87,705,920 probably benign Het
Inpp5k C A 11: 75,639,530 Y265* probably null Het
Klhl33 T G 14: 50,891,683 E436D probably damaging Het
Krt80 A G 15: 101,370,017 L13P probably benign Het
Krtap19-2 C T 16: 88,873,861 probably benign Het
March10 T C 11: 105,389,882 T526A probably benign Het
Mcrs1 A G 15: 99,248,455 probably null Het
Msh2 G T 17: 87,717,544 V617F possibly damaging Het
Nckap1 A C 2: 80,541,530 probably benign Het
Nek4 T A 14: 30,959,306 probably benign Het
Olfr1054 G T 2: 86,333,131 T75K probably damaging Het
Olfr1410 T A 1: 92,608,749 V304E probably damaging Het
Olfr875 T C 9: 37,773,553 V298A probably benign Het
Osgin1 A G 8: 119,442,508 H48R probably damaging Het
Pam T A 1: 97,884,195 T369S probably benign Het
Pclo C T 5: 14,713,830 Q821* probably null Het
Plekhm1 T C 11: 103,394,944 I222V probably benign Het
Ptprg T G 14: 12,199,783 N65K possibly damaging Het
Pum2 T A 12: 8,721,710 V351E probably damaging Het
Slc25a54 T A 3: 109,107,230 probably benign Het
Smchd1 A T 17: 71,429,543 D587E possibly damaging Het
Stap1 A G 5: 86,090,964 M164V probably benign Het
Stat5a T C 11: 100,861,426 V30A probably damaging Het
Stk36 T G 1: 74,602,206 probably benign Het
Tiam1 G T 16: 89,817,951 probably benign Het
Tmc5 T C 7: 118,666,576 M553T probably damaging Het
Tmem14a T A 1: 21,229,412 Y89N possibly damaging Het
Tpp2 A G 1: 43,990,530 Y991C probably damaging Het
Ttc7 A G 17: 87,359,151 K615E possibly damaging Het
Ubac2 C T 14: 121,994,342 P227S probably damaging Het
Vit A C 17: 78,625,159 K565T probably damaging Het
Vps13c T C 9: 67,945,851 F2409L possibly damaging Het
Wdr64 A G 1: 175,726,392 T173A probably damaging Het
Zfp759 T C 13: 67,137,355 I60T probably benign Het
Zfp81 A G 17: 33,334,377 S488P probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Olfr871
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Olfr871 APN 9 20212459 missense possibly damaging 0.89
IGL02291:Olfr871 APN 9 20212802 missense probably benign 0.00
IGL02312:Olfr871 APN 9 20213081 missense probably damaging 1.00
IGL02345:Olfr871 APN 9 20213018 missense possibly damaging 0.88
R0278:Olfr871 UTSW 9 20212886 missense probably damaging 1.00
R1606:Olfr871 UTSW 9 20212946 missense probably benign 0.05
R3751:Olfr871 UTSW 9 20213260 missense probably damaging 0.98
R4701:Olfr871 UTSW 9 20212625 missense probably damaging 1.00
R4811:Olfr871 UTSW 9 20212753 missense probably damaging 1.00
R5074:Olfr871 UTSW 9 20212582 missense possibly damaging 0.63
R5406:Olfr871 UTSW 9 20213158 missense probably benign 0.08
R6541:Olfr871 UTSW 9 20212399 missense probably benign 0.01
R6730:Olfr871 UTSW 9 20212502 missense probably benign 0.04
R7195:Olfr871 UTSW 9 20212544 missense probably damaging 0.99
R7197:Olfr871 UTSW 9 20212555 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGGTTCTCTGGTTTTCACAAGGTTC -3'
(R):5'- GGAGAAGTATGTCCATGCCTCCAAAG -3'

Sequencing Primer
(F):5'- ACACATGTCTCCTAAAGGGAAAG -3'
(R):5'- GAGCATGAAAAAATAAATCTGGGTG -3'
Posted On2013-06-12