Incidental Mutation 'R6087:Olfr1129'
ID484593
Institutional Source Beutler Lab
Gene Symbol Olfr1129
Ensembl Gene ENSMUSG00000062272
Gene Nameolfactory receptor 1129
SynonymsGA_x6K02T2Q125-49078087-49079031, MOR264-9P, MOR264-23
MMRRC Submission 044244-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6087 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location87573902-87577259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87575915 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 277 (D277G)
Ref Sequence ENSEMBL: ENSMUSP00000150986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081034] [ENSMUST00000213315] [ENSMUST00000214773]
Predicted Effect probably benign
Transcript: ENSMUST00000081034
AA Change: D277G

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079823
Gene: ENSMUSG00000062272
AA Change: D277G

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 6e-53 PFAM
Pfam:7tm_1 47 296 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213315
AA Change: D277G

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000214773
AA Change: D277G

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,971,762 K126R possibly damaging Het
9330182L06Rik T C 5: 9,399,255 S128P probably damaging Het
Adam7 A T 14: 68,510,757 C548S probably damaging Het
Adar C A 3: 89,745,590 H260N probably benign Het
Ak9 A G 10: 41,382,832 E775G probably benign Het
Arhgap35 T C 7: 16,563,643 Y499C probably damaging Het
Bank1 A G 3: 136,066,429 L480P probably damaging Het
Cep135 G T 5: 76,615,791 probably null Het
Cnga1 G T 5: 72,610,812 A177E probably damaging Het
Cubn T A 2: 13,427,847 D1221V probably damaging Het
Cyp2d40 T C 15: 82,764,004 Y36C possibly damaging Het
Dock8 C A 19: 25,161,074 N1254K probably benign Het
Fam13b C T 18: 34,487,139 V231I possibly damaging Het
Fbxo8 T A 8: 56,569,318 Y122N probably damaging Het
Fmo2 T A 1: 162,880,433 I378F probably benign Het
Golga3 A T 5: 110,204,946 Q861L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ighv3-8 G T 12: 114,322,380 A114E probably damaging Het
Itga3 C T 11: 95,052,443 probably null Het
Kank1 G A 19: 25,409,724 V254I probably benign Het
Lipo5 A T 19: 33,465,975 I147K unknown Het
Lrfn2 A G 17: 49,071,126 S412G probably benign Het
Lrrn3 T C 12: 41,453,535 N261S possibly damaging Het
Mical2 C T 7: 112,318,485 Q350* probably null Het
Nras T C 3: 103,060,321 F78L probably damaging Het
Nudt9 A G 5: 104,050,813 I65V probably benign Het
Olfr1293-ps A T 2: 111,528,181 E289V possibly damaging Het
Oscar G A 7: 3,611,312 P143S probably benign Het
Pla2g4d C T 2: 120,270,006 G615D probably damaging Het
Plekha1 T G 7: 130,900,571 S175A probably benign Het
Psg27 T C 7: 18,556,944 K445E probably benign Het
Rad51c A G 11: 87,380,879 Y318H probably benign Het
Ret G T 6: 118,176,291 T472K possibly damaging Het
Tarbp1 T C 8: 126,428,970 D1343G probably benign Het
Top2b C A 14: 16,409,864 R844S probably benign Het
Vmn1r171 T A 7: 23,633,004 M218K probably damaging Het
Vmn2r89 A T 14: 51,457,576 probably null Het
Zc3h13 T A 14: 75,330,709 D1147E probably damaging Het
Zgrf1 T A 3: 127,615,486 L1703H probably damaging Het
Other mutations in Olfr1129
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Olfr1129 APN 2 87575174 missense probably damaging 1.00
IGL01731:Olfr1129 APN 2 87575938 missense probably benign 0.26
IGL01819:Olfr1129 APN 2 87575479 missense probably damaging 1.00
IGL01995:Olfr1129 APN 2 87575462 missense probably damaging 1.00
IGL02280:Olfr1129 APN 2 87575345 missense probably damaging 0.98
IGL02451:Olfr1129 APN 2 87575232 missense probably benign 0.02
IGL02514:Olfr1129 APN 2 87575193 missense probably benign
IGL03039:Olfr1129 APN 2 87575192 missense probably benign 0.01
IGL03074:Olfr1129 APN 2 87575336 missense possibly damaging 0.66
R0396:Olfr1129 UTSW 2 87575567 missense possibly damaging 0.95
R0960:Olfr1129 UTSW 2 87575935 missense probably benign 0.44
R1955:Olfr1129 UTSW 2 87576005 missense probably damaging 1.00
R2006:Olfr1129 UTSW 2 87575192 missense probably benign 0.01
R3752:Olfr1129 UTSW 2 87575713 missense probably benign
R4546:Olfr1129 UTSW 2 87575186 missense probably benign 0.03
R4812:Olfr1129 UTSW 2 87575743 missense probably benign 0.11
R5327:Olfr1129 UTSW 2 87575699 missense probably damaging 1.00
R5845:Olfr1129 UTSW 2 87576023 missense probably benign 0.06
R6057:Olfr1129 UTSW 2 87576019 missense probably benign
R6125:Olfr1129 UTSW 2 87575246 missense probably benign 0.01
R6496:Olfr1129 UTSW 2 87575116 missense probably damaging 1.00
R6805:Olfr1129 UTSW 2 87574918 splice site probably null
R6967:Olfr1129 UTSW 2 87575513 missense possibly damaging 0.50
R7286:Olfr1129 UTSW 2 87575519 missense probably benign 0.00
R7296:Olfr1129 UTSW 2 87575708 missense probably damaging 1.00
Z1088:Olfr1129 UTSW 2 87575680 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CGGAGACACGTCAATTAATGAGC -3'
(R):5'- CTGATGCTTTTCTTCAGTAACTGTG -3'

Sequencing Primer
(F):5'- CACGTCAATTAATGAGCTATCTGTC -3'
(R):5'- TGCTTTTCTTCAGTAACTGTGTTAAG -3'
Posted On2017-08-16