Incidental Mutation 'R6087:Nras'
ID484597
Institutional Source Beutler Lab
Gene Symbol Nras
Ensembl Gene ENSMUSG00000027852
Gene Nameneuroblastoma ras oncogene
SynonymsN-ras
MMRRC Submission 044244-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock #R6087 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location103058285-103067914 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103060321 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 78 (F78L)
Ref Sequence ENSEMBL: ENSMUSP00000142603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029445] [ENSMUST00000029446] [ENSMUST00000128264] [ENSMUST00000196355] [ENSMUST00000197488] [ENSMUST00000197678] [ENSMUST00000197827] [ENSMUST00000198180] [ENSMUST00000199049] [ENSMUST00000199240] [ENSMUST00000199367] [ENSMUST00000199420] [ENSMUST00000199571] [ENSMUST00000200069] [ENSMUST00000200457]
Predicted Effect probably damaging
Transcript: ENSMUST00000029445
AA Change: F78L

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029445
Gene: ENSMUSG00000027852
AA Change: F78L

DomainStartEndE-ValueType
RAS 1 166 1.09e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029446
SMART Domains Protein: ENSMUSP00000029446
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 187 248 1.52e-19 SMART
CSP 350 413 6.22e-16 SMART
CSP 520 582 2.86e-15 SMART
CSP 675 738 2.2e-16 SMART
Pfam:SUZ-C 757 788 3.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128264
Predicted Effect probably damaging
Transcript: ENSMUST00000196355
AA Change: F78L

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142438
Gene: ENSMUSG00000027852
AA Change: F78L

DomainStartEndE-ValueType
RAS 1 166 1.09e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197488
SMART Domains Protein: ENSMUSP00000143524
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 726 757 1.7e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197678
AA Change: F78L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142603
Gene: ENSMUSG00000027852
AA Change: F78L

DomainStartEndE-ValueType
RAS 1 150 4.08e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197827
SMART Domains Protein: ENSMUSP00000143503
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 187 248 1.52e-19 SMART
CSP 350 413 6.22e-16 SMART
CSP 520 582 2.86e-15 SMART
CSP 675 738 2.2e-16 SMART
Pfam:SUZ-C 757 788 3.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197844
Predicted Effect probably benign
Transcript: ENSMUST00000198174
Predicted Effect probably benign
Transcript: ENSMUST00000198180
SMART Domains Protein: ENSMUSP00000142983
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 725 758 5.4e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199049
AA Change: F78L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143644
Gene: ENSMUSG00000027852
AA Change: F78L

DomainStartEndE-ValueType
RAS 1 166 5.3e-123 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199240
SMART Domains Protein: ENSMUSP00000143050
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 57 118 9e-22 SMART
CSP 220 283 3.8e-18 SMART
CSP 390 452 1.7e-17 SMART
CSP 545 608 1.4e-18 SMART
Pfam:SUZ-C 626 659 6.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199367
SMART Domains Protein: ENSMUSP00000143620
Gene: ENSMUSG00000027852

DomainStartEndE-ValueType
small_GTPase 1 74 1.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199420
SMART Domains Protein: ENSMUSP00000142703
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 725 758 5.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199571
SMART Domains Protein: ENSMUSP00000143028
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 725 758 5.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199776
Predicted Effect probably damaging
Transcript: ENSMUST00000200069
AA Change: F78L

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143391
Gene: ENSMUSG00000027852
AA Change: F78L

DomainStartEndE-ValueType
RAS 1 166 1.09e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200457
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This is an N-ras oncogene encoding a membrane protein that shuttles between the Golgi apparatus and the plasma membrane. This shuttling is regulated through palmitoylation and depalmitoylation by the ZDHHC9-GOLGA7 complex. The encoded protein, which has intrinsic GTPase activity, is activated by a guanine nucleotide-exchange factor and inactivated by a GTPase activating protein. Mutations in this gene have been associated with somatic rectal cancer, follicular thyroid cancer, autoimmune lymphoproliferative syndrome, Noonan syndrome, and juvenile myelomonocytic leukemia. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile with no gross morphological or histological abnormalities, or defects in peripheral blood cell populations. Mice homozygous for an LTR insertion in intron 1 exhibit weight loss immune defectsand postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,971,762 K126R possibly damaging Het
9330182L06Rik T C 5: 9,399,255 S128P probably damaging Het
Adam7 A T 14: 68,510,757 C548S probably damaging Het
Adar C A 3: 89,745,590 H260N probably benign Het
Ak9 A G 10: 41,382,832 E775G probably benign Het
Arhgap35 T C 7: 16,563,643 Y499C probably damaging Het
Bank1 A G 3: 136,066,429 L480P probably damaging Het
Cep135 G T 5: 76,615,791 probably null Het
Cnga1 G T 5: 72,610,812 A177E probably damaging Het
Cubn T A 2: 13,427,847 D1221V probably damaging Het
Cyp2d40 T C 15: 82,764,004 Y36C possibly damaging Het
Dock8 C A 19: 25,161,074 N1254K probably benign Het
Fam13b C T 18: 34,487,139 V231I possibly damaging Het
Fbxo8 T A 8: 56,569,318 Y122N probably damaging Het
Fmo2 T A 1: 162,880,433 I378F probably benign Het
Golga3 A T 5: 110,204,946 Q861L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ighv3-8 G T 12: 114,322,380 A114E probably damaging Het
Itga3 C T 11: 95,052,443 probably null Het
Kank1 G A 19: 25,409,724 V254I probably benign Het
Lipo5 A T 19: 33,465,975 I147K unknown Het
Lrfn2 A G 17: 49,071,126 S412G probably benign Het
Lrrn3 T C 12: 41,453,535 N261S possibly damaging Het
Mical2 C T 7: 112,318,485 Q350* probably null Het
Nudt9 A G 5: 104,050,813 I65V probably benign Het
Olfr1129 A G 2: 87,575,915 D277G probably benign Het
Olfr1293-ps A T 2: 111,528,181 E289V possibly damaging Het
Oscar G A 7: 3,611,312 P143S probably benign Het
Pla2g4d C T 2: 120,270,006 G615D probably damaging Het
Plekha1 T G 7: 130,900,571 S175A probably benign Het
Psg27 T C 7: 18,556,944 K445E probably benign Het
Rad51c A G 11: 87,380,879 Y318H probably benign Het
Ret G T 6: 118,176,291 T472K possibly damaging Het
Tarbp1 T C 8: 126,428,970 D1343G probably benign Het
Top2b C A 14: 16,409,864 R844S probably benign Het
Vmn1r171 T A 7: 23,633,004 M218K probably damaging Het
Vmn2r89 A T 14: 51,457,576 probably null Het
Zc3h13 T A 14: 75,330,709 D1147E probably damaging Het
Zgrf1 T A 3: 127,615,486 L1703H probably damaging Het
Other mutations in Nras
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Nras APN 3 103058916 utr 5 prime probably benign
IGL01443:Nras APN 3 103062435 missense probably benign 0.21
IGL03327:Nras APN 3 103059024 missense probably damaging 1.00
R0697:Nras UTSW 3 103060300 missense possibly damaging 0.89
R1688:Nras UTSW 3 103060373 missense probably benign
R1753:Nras UTSW 3 103058979 missense probably damaging 1.00
R2296:Nras UTSW 3 103059034 critical splice donor site probably null
R3977:Nras UTSW 3 103060225 missense probably benign 0.10
R3979:Nras UTSW 3 103060225 missense probably benign 0.10
R6194:Nras UTSW 3 103058953 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATTGAGCCTGTCCTTGTC -3'
(R):5'- GGCACATATCTGCTGTTGCAC -3'

Sequencing Primer
(F):5'- TGCTGGACATACTGGACA -3'
(R):5'- TGTTCTGGCCTCCACAAAAC -3'
Posted On2017-08-16