Incidental Mutation 'R6087:Fbxo8'
ID484613
Institutional Source Beutler Lab
Gene Symbol Fbxo8
Ensembl Gene ENSMUSG00000038206
Gene NameF-box protein 8
SynonymsFbx8
MMRRC Submission 044244-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6087 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location56551090-56593939 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56569318 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 122 (Y122N)
Ref Sequence ENSEMBL: ENSMUSP00000105951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040218] [ENSMUST00000110322] [ENSMUST00000210863]
Predicted Effect probably damaging
Transcript: ENSMUST00000040218
AA Change: Y122N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037544
Gene: ENSMUSG00000038206
AA Change: Y122N

DomainStartEndE-ValueType
Pfam:F-box-like 71 114 1.3e-8 PFAM
Sec7 132 316 2.52e-70 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110322
AA Change: Y122N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105951
Gene: ENSMUSG00000038206
AA Change: Y122N

DomainStartEndE-ValueType
Pfam:F-box-like 71 114 1.2e-9 PFAM
Blast:Sec7 132 159 8e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156840
Predicted Effect probably benign
Transcript: ENSMUST00000210863
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It contains a C-terminal amino acid sequence that bears a significant similarity with a portion of yeast Sec7p, a critical regulator of vesicular protein transport. This human protein may interact with ADP-ribosylation factor(s)(ARFs) and exhibit ARF-GEF (guanine nucleotide exchange factor) activity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,971,762 K126R possibly damaging Het
9330182L06Rik T C 5: 9,399,255 S128P probably damaging Het
Adam7 A T 14: 68,510,757 C548S probably damaging Het
Adar C A 3: 89,745,590 H260N probably benign Het
Ak9 A G 10: 41,382,832 E775G probably benign Het
Arhgap35 T C 7: 16,563,643 Y499C probably damaging Het
Bank1 A G 3: 136,066,429 L480P probably damaging Het
Cep135 G T 5: 76,615,791 probably null Het
Cnga1 G T 5: 72,610,812 A177E probably damaging Het
Cubn T A 2: 13,427,847 D1221V probably damaging Het
Cyp2d40 T C 15: 82,764,004 Y36C possibly damaging Het
Dock8 C A 19: 25,161,074 N1254K probably benign Het
Fam13b C T 18: 34,487,139 V231I possibly damaging Het
Fmo2 T A 1: 162,880,433 I378F probably benign Het
Golga3 A T 5: 110,204,946 Q861L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ighv3-8 G T 12: 114,322,380 A114E probably damaging Het
Itga3 C T 11: 95,052,443 probably null Het
Kank1 G A 19: 25,409,724 V254I probably benign Het
Lipo5 A T 19: 33,465,975 I147K unknown Het
Lrfn2 A G 17: 49,071,126 S412G probably benign Het
Lrrn3 T C 12: 41,453,535 N261S possibly damaging Het
Mical2 C T 7: 112,318,485 Q350* probably null Het
Nras T C 3: 103,060,321 F78L probably damaging Het
Nudt9 A G 5: 104,050,813 I65V probably benign Het
Olfr1129 A G 2: 87,575,915 D277G probably benign Het
Olfr1293-ps A T 2: 111,528,181 E289V possibly damaging Het
Oscar G A 7: 3,611,312 P143S probably benign Het
Pla2g4d C T 2: 120,270,006 G615D probably damaging Het
Plekha1 T G 7: 130,900,571 S175A probably benign Het
Psg27 T C 7: 18,556,944 K445E probably benign Het
Rad51c A G 11: 87,380,879 Y318H probably benign Het
Ret G T 6: 118,176,291 T472K possibly damaging Het
Tarbp1 T C 8: 126,428,970 D1343G probably benign Het
Top2b C A 14: 16,409,864 R844S probably benign Het
Vmn1r171 T A 7: 23,633,004 M218K probably damaging Het
Vmn2r89 A T 14: 51,457,576 probably null Het
Zc3h13 T A 14: 75,330,709 D1147E probably damaging Het
Zgrf1 T A 3: 127,615,486 L1703H probably damaging Het
Other mutations in Fbxo8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Fbxo8 APN 8 56588023 missense probably benign 0.20
IGL02699:Fbxo8 APN 8 56590188 missense possibly damaging 0.94
R0240:Fbxo8 UTSW 8 56590261 intron probably benign
R0295:Fbxo8 UTSW 8 56590074 missense probably benign 0.01
R0310:Fbxo8 UTSW 8 56590097 missense probably damaging 1.00
R0732:Fbxo8 UTSW 8 56591529 missense probably damaging 1.00
R3895:Fbxo8 UTSW 8 56591521 missense probably damaging 1.00
R4258:Fbxo8 UTSW 8 56588041 missense probably benign 0.05
R5162:Fbxo8 UTSW 8 56569319 missense probably damaging 1.00
R5687:Fbxo8 UTSW 8 56591517 missense probably damaging 1.00
R6297:Fbxo8 UTSW 8 56569288 missense probably damaging 1.00
R7422:Fbxo8 UTSW 8 56569282 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCGAGGTCACAAGACTCTTG -3'
(R):5'- AAAGGTTACACTATTAGAAGGCGGC -3'

Sequencing Primer
(F):5'- ACCTTCACAAGATTCCAGTTTTAG -3'
(R):5'- GCAGCAGGATCATACGCATGC -3'
Posted On2017-08-16