Incidental Mutation 'R6087:Itga3'
ID484617
Institutional Source Beutler Lab
Gene Symbol Itga3
Ensembl Gene ENSMUSG00000001507
Gene Nameintegrin alpha 3
SynonymsVLA-3 alpha 3, alpha3-integrin
MMRRC Submission 044244-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6087 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location95044474-95076801 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 95052443 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001548] [ENSMUST00000001548] [ENSMUST00000107739] [ENSMUST00000107739] [ENSMUST00000120375] [ENSMUST00000120375]
Predicted Effect probably null
Transcript: ENSMUST00000001548
SMART Domains Protein: ENSMUSP00000001548
Gene: ENSMUSG00000001507

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Int_alpha 48 110 4.18e-7 SMART
Int_alpha 246 300 5.01e0 SMART
Int_alpha 304 361 3.07e-14 SMART
Int_alpha 366 419 4.17e-16 SMART
Int_alpha 427 483 7.57e1 SMART
low complexity region 521 534 N/A INTRINSIC
SCOP:d1m1xa3 758 984 7e-54 SMART
transmembrane domain 994 1016 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000001548
SMART Domains Protein: ENSMUSP00000001548
Gene: ENSMUSG00000001507

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Int_alpha 48 110 4.18e-7 SMART
Int_alpha 246 300 5.01e0 SMART
Int_alpha 304 361 3.07e-14 SMART
Int_alpha 366 419 4.17e-16 SMART
Int_alpha 427 483 7.57e1 SMART
low complexity region 521 534 N/A INTRINSIC
SCOP:d1m1xa3 758 984 7e-54 SMART
transmembrane domain 994 1016 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107739
SMART Domains Protein: ENSMUSP00000103368
Gene: ENSMUSG00000001507

DomainStartEndE-ValueType
Int_alpha 20 79 1.05e2 SMART
Int_alpha 215 269 5.01e0 SMART
Int_alpha 273 330 3.07e-14 SMART
Int_alpha 335 388 4.17e-16 SMART
Int_alpha 396 452 7.57e1 SMART
low complexity region 490 503 N/A INTRINSIC
low complexity region 775 789 N/A INTRINSIC
transmembrane domain 963 985 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107739
SMART Domains Protein: ENSMUSP00000103368
Gene: ENSMUSG00000001507

DomainStartEndE-ValueType
Int_alpha 20 79 1.05e2 SMART
Int_alpha 215 269 5.01e0 SMART
Int_alpha 273 330 3.07e-14 SMART
Int_alpha 335 388 4.17e-16 SMART
Int_alpha 396 452 7.57e1 SMART
low complexity region 490 503 N/A INTRINSIC
low complexity region 775 789 N/A INTRINSIC
transmembrane domain 963 985 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120375
SMART Domains Protein: ENSMUSP00000113556
Gene: ENSMUSG00000001507

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Int_alpha 48 110 4.18e-7 SMART
Int_alpha 246 300 5.01e0 SMART
Int_alpha 304 361 3.07e-14 SMART
Int_alpha 366 419 4.17e-16 SMART
Int_alpha 427 483 7.57e1 SMART
low complexity region 521 534 N/A INTRINSIC
SCOP:d1m1xa3 758 984 2e-53 SMART
transmembrane domain 994 1016 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120375
SMART Domains Protein: ENSMUSP00000113556
Gene: ENSMUSG00000001507

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Int_alpha 48 110 4.18e-7 SMART
Int_alpha 246 300 5.01e0 SMART
Int_alpha 304 361 3.07e-14 SMART
Int_alpha 366 419 4.17e-16 SMART
Int_alpha 427 483 7.57e1 SMART
low complexity region 521 534 N/A INTRINSIC
SCOP:d1m1xa3 758 984 2e-53 SMART
transmembrane domain 994 1016 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141693
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subunit of integrin family of cell surface proteins. The encoded protein undergoes post-translational processing to form a disulfide bond-linked dimer comprised of heavy and light chains. At the cell surface, the encoded protein non-covalently associates with the integrin beta-1 subunit to form a heterodimer that interacts with many extracellular matrix proteins including fibronectin and laminin. Mice lacking the encoded protein die during the first day after birth due to severe abnormalities in kidneys. Mice lacking the encoded protein specifically in the basal layer of epidermis display several skin defects and accelerated wound healing. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the kidney and submandibular gland, decreased bronchial branching of the lungs, skin blisters at the dermal-epidermal junction, abnormal layering of the cerebral cortex and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,971,762 K126R possibly damaging Het
9330182L06Rik T C 5: 9,399,255 S128P probably damaging Het
Adam7 A T 14: 68,510,757 C548S probably damaging Het
Adar C A 3: 89,745,590 H260N probably benign Het
Ak9 A G 10: 41,382,832 E775G probably benign Het
Arhgap35 T C 7: 16,563,643 Y499C probably damaging Het
Bank1 A G 3: 136,066,429 L480P probably damaging Het
Cep135 G T 5: 76,615,791 probably null Het
Cnga1 G T 5: 72,610,812 A177E probably damaging Het
Cubn T A 2: 13,427,847 D1221V probably damaging Het
Cyp2d40 T C 15: 82,764,004 Y36C possibly damaging Het
Dock8 C A 19: 25,161,074 N1254K probably benign Het
Fam13b C T 18: 34,487,139 V231I possibly damaging Het
Fbxo8 T A 8: 56,569,318 Y122N probably damaging Het
Fmo2 T A 1: 162,880,433 I378F probably benign Het
Golga3 A T 5: 110,204,946 Q861L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ighv3-8 G T 12: 114,322,380 A114E probably damaging Het
Kank1 G A 19: 25,409,724 V254I probably benign Het
Lipo5 A T 19: 33,465,975 I147K unknown Het
Lrfn2 A G 17: 49,071,126 S412G probably benign Het
Lrrn3 T C 12: 41,453,535 N261S possibly damaging Het
Mical2 C T 7: 112,318,485 Q350* probably null Het
Nras T C 3: 103,060,321 F78L probably damaging Het
Nudt9 A G 5: 104,050,813 I65V probably benign Het
Olfr1129 A G 2: 87,575,915 D277G probably benign Het
Olfr1293-ps A T 2: 111,528,181 E289V possibly damaging Het
Oscar G A 7: 3,611,312 P143S probably benign Het
Pla2g4d C T 2: 120,270,006 G615D probably damaging Het
Plekha1 T G 7: 130,900,571 S175A probably benign Het
Psg27 T C 7: 18,556,944 K445E probably benign Het
Rad51c A G 11: 87,380,879 Y318H probably benign Het
Ret G T 6: 118,176,291 T472K possibly damaging Het
Tarbp1 T C 8: 126,428,970 D1343G probably benign Het
Top2b C A 14: 16,409,864 R844S probably benign Het
Vmn1r171 T A 7: 23,633,004 M218K probably damaging Het
Vmn2r89 A T 14: 51,457,576 probably null Het
Zc3h13 T A 14: 75,330,709 D1147E probably damaging Het
Zgrf1 T A 3: 127,615,486 L1703H probably damaging Het
Other mutations in Itga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Itga3 APN 11 95065886 missense probably damaging 1.00
IGL02020:Itga3 APN 11 95057390 missense probably benign 0.02
IGL02413:Itga3 APN 11 95068771 missense probably damaging 1.00
IGL02562:Itga3 APN 11 95068793 missense probably benign 0.02
PIT4508001:Itga3 UTSW 11 95055893 missense probably benign 0.20
R0485:Itga3 UTSW 11 95061970 missense probably benign 0.05
R1548:Itga3 UTSW 11 95046919 critical splice donor site probably null
R1677:Itga3 UTSW 11 95055759 missense probably damaging 0.96
R2062:Itga3 UTSW 11 95054076 missense possibly damaging 0.92
R2088:Itga3 UTSW 11 95052494 missense probably benign 0.10
R2679:Itga3 UTSW 11 95068310 splice site probably benign
R3697:Itga3 UTSW 11 95062725 missense probably benign 0.00
R3839:Itga3 UTSW 11 95057269 critical splice donor site probably null
R4210:Itga3 UTSW 11 95062623 missense probably benign 0.00
R4533:Itga3 UTSW 11 95057293 missense probably benign 0.15
R4849:Itga3 UTSW 11 95076271 missense probably benign
R4863:Itga3 UTSW 11 95061967 missense probably damaging 1.00
R4889:Itga3 UTSW 11 95068301 missense probably benign 0.13
R5218:Itga3 UTSW 11 95062748 missense probably benign 0.01
R6046:Itga3 UTSW 11 95062715 missense probably benign 0.28
R6210:Itga3 UTSW 11 95068891 intron probably benign
R6341:Itga3 UTSW 11 95055851 splice site probably null
R6666:Itga3 UTSW 11 95065826 missense probably benign 0.00
R6998:Itga3 UTSW 11 95051462 missense probably benign 0.00
R7106:Itga3 UTSW 11 95055873 missense probably benign 0.00
R7164:Itga3 UTSW 11 95052479 missense possibly damaging 0.85
R7267:Itga3 UTSW 11 95076362 intron probably benign
R7421:Itga3 UTSW 11 95068855 missense probably benign 0.20
R7514:Itga3 UTSW 11 95065896 nonsense probably null
R7533:Itga3 UTSW 11 95046518 missense not run
Predicted Primers PCR Primer
(F):5'- ATGTGGTCACAGTAACAGACAC -3'
(R):5'- TCCGAGAGTCCATCTTGCATG -3'

Sequencing Primer
(F):5'- CACAACTGTGCAGAACATGATAC -3'
(R):5'- TCACTCCAGGCTGGGATGAAATC -3'
Posted On2017-08-16