Incidental Mutation 'R6087:Lipo5'
ID484629
Institutional Source Beutler Lab
Gene Symbol Lipo5
Ensembl Gene ENSMUSG00000086875
Gene Namelipase, member O5
SynonymsGm8975
MMRRC Submission 044244-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6087 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location33459609-33473191 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33465975 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 147 (I147K)
Gene Model predicted gene model for transcript(s):
Predicted Effect unknown
Transcript: ENSMUST00000156818
AA Change: I147K
SMART Domains Protein: ENSMUSP00000121547
Gene: ENSMUSG00000086875
AA Change: I147K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 37 99 4e-25 PFAM
Pfam:Abhydrolase_1 80 217 3.3e-16 PFAM
Pfam:Abhydrolase_5 80 222 1.5e-7 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,971,762 K126R possibly damaging Het
9330182L06Rik T C 5: 9,399,255 S128P probably damaging Het
Adam7 A T 14: 68,510,757 C548S probably damaging Het
Adar C A 3: 89,745,590 H260N probably benign Het
Ak9 A G 10: 41,382,832 E775G probably benign Het
Arhgap35 T C 7: 16,563,643 Y499C probably damaging Het
Bank1 A G 3: 136,066,429 L480P probably damaging Het
Cep135 G T 5: 76,615,791 probably null Het
Cnga1 G T 5: 72,610,812 A177E probably damaging Het
Cubn T A 2: 13,427,847 D1221V probably damaging Het
Cyp2d40 T C 15: 82,764,004 Y36C possibly damaging Het
Dock8 C A 19: 25,161,074 N1254K probably benign Het
Fam13b C T 18: 34,487,139 V231I possibly damaging Het
Fbxo8 T A 8: 56,569,318 Y122N probably damaging Het
Fmo2 T A 1: 162,880,433 I378F probably benign Het
Golga3 A T 5: 110,204,946 Q861L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ighv3-8 G T 12: 114,322,380 A114E probably damaging Het
Itga3 C T 11: 95,052,443 probably null Het
Kank1 G A 19: 25,409,724 V254I probably benign Het
Lrfn2 A G 17: 49,071,126 S412G probably benign Het
Lrrn3 T C 12: 41,453,535 N261S possibly damaging Het
Mical2 C T 7: 112,318,485 Q350* probably null Het
Nras T C 3: 103,060,321 F78L probably damaging Het
Nudt9 A G 5: 104,050,813 I65V probably benign Het
Olfr1129 A G 2: 87,575,915 D277G probably benign Het
Olfr1293-ps A T 2: 111,528,181 E289V possibly damaging Het
Oscar G A 7: 3,611,312 P143S probably benign Het
Pla2g4d C T 2: 120,270,006 G615D probably damaging Het
Plekha1 T G 7: 130,900,571 S175A probably benign Het
Psg27 T C 7: 18,556,944 K445E probably benign Het
Rad51c A G 11: 87,380,879 Y318H probably benign Het
Ret G T 6: 118,176,291 T472K possibly damaging Het
Tarbp1 T C 8: 126,428,970 D1343G probably benign Het
Top2b C A 14: 16,409,864 R844S probably benign Het
Vmn1r171 T A 7: 23,633,004 M218K probably damaging Het
Vmn2r89 A T 14: 51,457,576 probably null Het
Zc3h13 T A 14: 75,330,709 D1147E probably damaging Het
Zgrf1 T A 3: 127,615,486 L1703H probably damaging Het
Other mutations in Lipo5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02162:Lipo5 APN 19 33468763 splice site probably benign
IGL02210:Lipo5 APN 19 33467877 missense unknown
IGL02689:Lipo5 APN 19 33467786 missense unknown
IGL03276:Lipo5 APN 19 33467842 missense unknown
PIT4382001:Lipo5 UTSW 19 33465939 missense probably null
R1456:Lipo5 UTSW 19 33465873 splice site probably benign
R1820:Lipo5 UTSW 19 33464595 splice site probably null
R3770:Lipo5 UTSW 19 33467800 missense unknown
R4658:Lipo5 UTSW 19 33464522 missense unknown
R4906:Lipo5 UTSW 19 33465948 missense unknown
R4951:Lipo5 UTSW 19 33468851 missense probably damaging 0.98
R5304:Lipo5 UTSW 19 33467749 missense unknown
R5526:Lipo5 UTSW 19 33467884 missense unknown
R6110:Lipo5 UTSW 19 33467917 missense unknown
R7077:Lipo5 UTSW 19 33467770 missense
R7094:Lipo5 UTSW 19 33468849 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGGCTGCAGTTGTTATCATCTGATAG -3'
(R):5'- TGAGCATAAGGTGGTATCATAGTG -3'

Sequencing Primer
(F):5'- TCTGTGTTTTACAAAGATGTGTACTG -3'
(R):5'- CATAAGGTGGTATCATAGTGAAAGTG -3'
Posted On2017-08-16