Incidental Mutation 'R6089:Baz2a'
List |< first << previous [record 56 of 585] next >> last >|
ID484669
Institutional Source Beutler Lab
Gene Symbol Baz2a
Ensembl Gene ENSMUSG00000040054
Gene Namebromodomain adjacent to zinc finger domain, 2A
SynonymsC030005G16Rik, Tip5, Walp3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.466) question?
Stock #R6089 (G1)
Quality Score217.468
Status Not validated
Chromosome10
Chromosomal Location128091577-128129303 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) TCTCCTC to TCTC at 128114642 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045621] [ENSMUST00000170054] [ENSMUST00000217851] [ENSMUST00000219072] [ENSMUST00000220049]
Predicted Effect probably benign
Transcript: ENSMUST00000045621
SMART Domains Protein: ENSMUSP00000044359
Gene: ENSMUSG00000040054

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
low complexity region 342 353 N/A INTRINSIC
low complexity region 421 475 N/A INTRINSIC
low complexity region 518 529 N/A INTRINSIC
MBD 539 614 3.87e-35 SMART
AT_hook 639 651 2.38e0 SMART
AT_hook 660 672 1.65e0 SMART
low complexity region 697 710 N/A INTRINSIC
coiled coil region 736 776 N/A INTRINSIC
DDT 837 902 3.75e-18 SMART
Pfam:WHIM1 939 988 4.8e-8 PFAM
low complexity region 1001 1013 N/A INTRINSIC
AT_hook 1174 1186 6.23e1 SMART
AT_hook 1388 1400 4.21e0 SMART
Pfam:WHIM3 1423 1464 1e-9 PFAM
PHD 1662 1708 1.47e-11 SMART
low complexity region 1741 1753 N/A INTRINSIC
BROMO 1773 1881 7.71e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170054
SMART Domains Protein: ENSMUSP00000129803
Gene: ENSMUSG00000040054

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
low complexity region 343 354 N/A INTRINSIC
low complexity region 422 476 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
MBD 540 615 3.87e-35 SMART
AT_hook 640 652 2.38e0 SMART
AT_hook 661 673 1.65e0 SMART
low complexity region 698 711 N/A INTRINSIC
coiled coil region 737 777 N/A INTRINSIC
DDT 838 903 3.75e-18 SMART
Pfam:WHIM1 940 989 4.8e-8 PFAM
low complexity region 1002 1014 N/A INTRINSIC
AT_hook 1175 1187 6.23e1 SMART
AT_hook 1389 1401 4.21e0 SMART
Pfam:WHIM3 1424 1462 5.5e-19 PFAM
PHD 1663 1709 1.47e-11 SMART
low complexity region 1742 1754 N/A INTRINSIC
BROMO 1774 1882 7.71e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218772
Predicted Effect probably benign
Transcript: ENSMUST00000219072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219980
Predicted Effect probably benign
Transcript: ENSMUST00000220049
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T G 7: 118,746,435 S59A possibly damaging Het
A830010M20Rik C T 5: 107,507,029 A386V probably damaging Het
Actr3 A G 1: 125,407,395 V95A probably damaging Het
Ankrd40 A T 11: 94,333,925 K53N probably damaging Het
Ash1l C T 3: 89,053,143 Q2338* probably null Het
Astn2 A G 4: 65,794,573 F610S probably damaging Het
Calm4 A T 13: 3,837,874 probably benign Het
Card10 T C 15: 78,802,414 T68A probably benign Het
Cars2 A G 8: 11,530,301 M245T probably damaging Het
Cat C A 2: 103,472,951 L160F probably null Het
Cers5 G T 15: 99,741,002 T144K probably benign Het
Cyp3a13 T A 5: 137,909,953 L211F probably benign Het
Defb4 A T 8: 19,201,305 R63* probably null Het
Dnah14 G T 1: 181,750,154 W3012L probably damaging Het
Dusp18 A G 11: 3,897,555 T182A probably benign Het
Dzip1l C A 9: 99,642,684 T286K possibly damaging Het
Eif2ak3 A T 6: 70,896,934 T944S possibly damaging Het
Fbn1 A T 2: 125,321,225 I2119N possibly damaging Het
Gabbr2 A G 4: 46,846,448 S154P probably damaging Het
Gm15440 A T 13: 51,691,401 H107Q unknown Het
Grm2 G A 9: 106,653,891 P133L probably damaging Het
Gsdme A G 6: 50,251,305 V61A probably damaging Het
Gtpbp1 A G 15: 79,706,997 T23A probably benign Het
Helz A T 11: 107,595,137 probably null Het
Herc1 A C 9: 66,445,532 H2100P probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ifngr1 T C 10: 19,606,300 S213P probably benign Het
Itgb7 T C 15: 102,217,286 D636G probably benign Het
Mre11a G A 9: 14,819,464 D491N probably benign Het
Muc16 A G 9: 18,643,252 L3915P unknown Het
Myh1 T A 11: 67,202,167 probably null Het
Myh1 T G 11: 67,220,787 probably null Het
Myh7b C T 2: 155,622,489 T608M probably damaging Het
Myof T C 19: 37,967,060 K23E probably benign Het
Nacad A G 11: 6,601,331 V620A probably benign Het
Pbrm1 T C 14: 31,087,585 Y1121H probably damaging Het
Pcdha9 T C 18: 36,998,498 F207L probably benign Het
Pcdhb10 T C 18: 37,413,626 V585A possibly damaging Het
Pigg A T 5: 108,341,922 M798L probably benign Het
Poc5 G T 13: 96,396,671 M102I probably damaging Het
Ppp2r3a T A 9: 101,211,636 Q496L probably benign Het
Ptprf A G 4: 118,211,084 Y1752H probably damaging Het
Ptpru G C 4: 131,772,630 S1244R possibly damaging Het
Rnf213 A G 11: 119,416,559 K682E probably benign Het
Rtp3 T C 9: 110,986,973 D170G probably benign Het
Sall4 T C 2: 168,755,486 D478G possibly damaging Het
Scai A T 2: 39,083,554 Y58* probably null Het
Simc1 G A 13: 54,528,490 V1007M probably benign Het
Tcf20 G T 15: 82,853,208 D1347E probably benign Het
Tdo2 T C 3: 81,962,728 Y279C probably damaging Het
Trdn C T 10: 33,464,575 P602S probably benign Het
Txndc5 A T 13: 38,523,416 M1K probably null Het
Ubr2 A C 17: 46,982,292 M356R possibly damaging Het
Uqcrc2 A T 7: 120,654,009 D332V probably damaging Het
Usp48 T C 4: 137,605,818 F108L probably damaging Het
Vill A G 9: 119,057,799 N4S probably benign Het
Vmn1r11 T C 6: 57,137,660 V103A possibly damaging Het
Vmn2r98 A G 17: 19,066,074 D278G probably benign Het
Wfdc15a A T 2: 164,199,666 L79* probably null Het
Xxylt1 C T 16: 31,080,981 V119M probably damaging Het
Zfp26 G T 9: 20,437,693 A525D probably damaging Het
Zgrf1 G A 3: 127,595,993 G396D probably damaging Het
Zkscan16 A G 4: 58,948,889 D148G possibly damaging Het
Zscan26 G T 13: 21,448,329 S77R probably damaging Het
Other mutations in Baz2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Baz2a APN 10 128124935 missense probably benign 0.00
IGL00501:Baz2a APN 10 128114625 missense probably benign 0.14
IGL00743:Baz2a APN 10 128114526 missense probably benign
IGL01362:Baz2a APN 10 128121964 missense probably damaging 0.98
IGL01394:Baz2a APN 10 128118645 missense possibly damaging 0.46
IGL01603:Baz2a APN 10 128111168 missense probably damaging 0.98
IGL02165:Baz2a APN 10 128119349 missense probably benign 0.03
IGL02732:Baz2a APN 10 128125175 missense possibly damaging 0.66
IGL03030:Baz2a APN 10 128125146 missense possibly damaging 0.62
IGL03087:Baz2a APN 10 128122313 missense probably damaging 0.99
R0255:Baz2a UTSW 10 128114639 missense possibly damaging 0.66
R0737:Baz2a UTSW 10 128116080 missense possibly damaging 0.92
R0742:Baz2a UTSW 10 128113666 nonsense probably null
R0755:Baz2a UTSW 10 128119691 missense possibly damaging 0.92
R0798:Baz2a UTSW 10 128126323 splice site probably benign
R0879:Baz2a UTSW 10 128121304 missense probably damaging 0.99
R1023:Baz2a UTSW 10 128121807 missense possibly damaging 0.66
R1482:Baz2a UTSW 10 128109008 missense possibly damaging 0.92
R1512:Baz2a UTSW 10 128124152 missense possibly damaging 0.95
R1658:Baz2a UTSW 10 128124383 missense probably benign 0.04
R1983:Baz2a UTSW 10 128123959 missense probably benign 0.14
R2059:Baz2a UTSW 10 128113578 missense probably damaging 0.98
R2141:Baz2a UTSW 10 128123612 missense probably damaging 1.00
R2921:Baz2a UTSW 10 128125077 frame shift probably null
R2922:Baz2a UTSW 10 128125077 frame shift probably null
R3104:Baz2a UTSW 10 128125077 frame shift probably null
R3105:Baz2a UTSW 10 128125077 frame shift probably null
R3106:Baz2a UTSW 10 128125077 frame shift probably null
R3621:Baz2a UTSW 10 128125077 frame shift probably null
R3872:Baz2a UTSW 10 128124110 missense probably damaging 1.00
R3873:Baz2a UTSW 10 128124110 missense probably damaging 1.00
R3875:Baz2a UTSW 10 128124110 missense probably damaging 1.00
R4600:Baz2a UTSW 10 128121183 missense probably damaging 0.97
R4692:Baz2a UTSW 10 128124893 missense probably damaging 1.00
R4717:Baz2a UTSW 10 128124942 missense possibly damaging 0.83
R4821:Baz2a UTSW 10 128111109 missense probably damaging 1.00
R4832:Baz2a UTSW 10 128123130 missense probably benign 0.08
R4893:Baz2a UTSW 10 128123415 missense possibly damaging 0.66
R4907:Baz2a UTSW 10 128110808 missense probably damaging 0.99
R5133:Baz2a UTSW 10 128116126 missense probably damaging 1.00
R5340:Baz2a UTSW 10 128115042 missense probably damaging 1.00
R5527:Baz2a UTSW 10 128124917 missense probably damaging 1.00
R5761:Baz2a UTSW 10 128119690 missense possibly damaging 0.66
R5891:Baz2a UTSW 10 128121322 missense probably damaging 1.00
R6088:Baz2a UTSW 10 128114642 small deletion probably benign
R6323:Baz2a UTSW 10 128126417 missense probably benign 0.21
R6894:Baz2a UTSW 10 128123581 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GTACTCAACTACATCCAGCAGTTTC -3'
(R):5'- CCATATGTGACATGTGCTTCTG -3'

Sequencing Primer
(F):5'- TCCAGCAGTTTCACCAACAG -3'
(R):5'- TGACATGTGCTTCTGTAGAGAAC -3'
Posted On2017-08-16