Incidental Mutation 'R6089:Vmn2r98'
ID484690
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Namevomeronasal 2, receptor 98
SynonymsEG224552
MMRRC Submission 044246-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R6089 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location19053460-19082411 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19066074 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 278 (D278G)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
Predicted Effect probably benign
Transcript: ENSMUST00000170424
AA Change: D278G

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: D278G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T G 7: 118,746,435 S59A possibly damaging Het
A830010M20Rik C T 5: 107,507,029 A386V probably damaging Het
Actr3 A G 1: 125,407,395 V95A probably damaging Het
Ankrd40 A T 11: 94,333,925 K53N probably damaging Het
Ash1l C T 3: 89,053,143 Q2338* probably null Het
Astn2 A G 4: 65,794,573 F610S probably damaging Het
Baz2a TCTCCTC TCTC 10: 128,114,642 probably benign Het
Calm4 A T 13: 3,837,874 probably benign Het
Card10 T C 15: 78,802,414 T68A probably benign Het
Cars2 A G 8: 11,530,301 M245T probably damaging Het
Cat C A 2: 103,472,951 L160F probably null Het
Cers5 G T 15: 99,741,002 T144K probably benign Het
Cyp3a13 T A 5: 137,909,953 L211F probably benign Het
Defb4 A T 8: 19,201,305 R63* probably null Het
Dnah14 G T 1: 181,750,154 W3012L probably damaging Het
Dusp18 A G 11: 3,897,555 T182A probably benign Het
Dzip1l C A 9: 99,642,684 T286K possibly damaging Het
Eif2ak3 A T 6: 70,896,934 T944S possibly damaging Het
Fbn1 A T 2: 125,321,225 I2119N possibly damaging Het
Gabbr2 A G 4: 46,846,448 S154P probably damaging Het
Gm15440 A T 13: 51,691,401 H107Q unknown Het
Grm2 G A 9: 106,653,891 P133L probably damaging Het
Gsdme A G 6: 50,251,305 V61A probably damaging Het
Gtpbp1 A G 15: 79,706,997 T23A probably benign Het
Helz A T 11: 107,595,137 probably null Het
Herc1 A C 9: 66,445,532 H2100P probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ifngr1 T C 10: 19,606,300 S213P probably benign Het
Itgb7 T C 15: 102,217,286 D636G probably benign Het
Mre11a G A 9: 14,819,464 D491N probably benign Het
Muc16 A G 9: 18,643,252 L3915P unknown Het
Myh1 T A 11: 67,202,167 probably null Het
Myh1 T G 11: 67,220,787 probably null Het
Myh7b C T 2: 155,622,489 T608M probably damaging Het
Myof T C 19: 37,967,060 K23E probably benign Het
Nacad A G 11: 6,601,331 V620A probably benign Het
Pbrm1 T C 14: 31,087,585 Y1121H probably damaging Het
Pcdha9 T C 18: 36,998,498 F207L probably benign Het
Pcdhb10 T C 18: 37,413,626 V585A possibly damaging Het
Pigg A T 5: 108,341,922 M798L probably benign Het
Poc5 G T 13: 96,396,671 M102I probably damaging Het
Ppp2r3a T A 9: 101,211,636 Q496L probably benign Het
Ptprf A G 4: 118,211,084 Y1752H probably damaging Het
Ptpru G C 4: 131,772,630 S1244R possibly damaging Het
Rnf213 A G 11: 119,416,559 K682E probably benign Het
Rtp3 T C 9: 110,986,973 D170G probably benign Het
Sall4 T C 2: 168,755,486 D478G possibly damaging Het
Scai A T 2: 39,083,554 Y58* probably null Het
Simc1 G A 13: 54,528,490 V1007M probably benign Het
Tcf20 G T 15: 82,853,208 D1347E probably benign Het
Tdo2 T C 3: 81,962,728 Y279C probably damaging Het
Trdn C T 10: 33,464,575 P602S probably benign Het
Txndc5 A T 13: 38,523,416 M1K probably null Het
Ubr2 A C 17: 46,982,292 M356R possibly damaging Het
Uqcrc2 A T 7: 120,654,009 D332V probably damaging Het
Usp48 T C 4: 137,605,818 F108L probably damaging Het
Vill A G 9: 119,057,799 N4S probably benign Het
Vmn1r11 T C 6: 57,137,660 V103A possibly damaging Het
Wfdc15a A T 2: 164,199,666 L79* probably null Het
Xxylt1 C T 16: 31,080,981 V119M probably damaging Het
Zfp26 G T 9: 20,437,693 A525D probably damaging Het
Zgrf1 G A 3: 127,595,993 G396D probably damaging Het
Zkscan16 A G 4: 58,948,889 D148G possibly damaging Het
Zscan26 G T 13: 21,448,329 S77R probably damaging Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19065745 splice site probably benign
IGL01296:Vmn2r98 APN 17 19065185 missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19065758 missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19065259 missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19066451 missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19066286 missense probably benign
IGL02123:Vmn2r98 APN 17 19080679 missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19065851 missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19065821 missense probably benign
IGL02650:Vmn2r98 APN 17 19080961 missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19065259 missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19066013 missense probably benign
IGL02807:Vmn2r98 APN 17 19081021 missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19065980 missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19069845 missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19080961 missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19066400 missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19065827 nonsense probably null
R0545:Vmn2r98 UTSW 17 19053613 missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19080497 missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19080520 missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19080749 missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19065948 missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19065178 missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19080908 missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19066440 missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19066418 missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19065333 nonsense probably null
R2165:Vmn2r98 UTSW 17 19081291 missense unknown
R2238:Vmn2r98 UTSW 17 19065951 missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19080436 missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19065819 missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19081177 missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19067402 missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19080625 missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19066092 missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19069745 missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19066340 missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19066157 missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19066044 missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19053553 missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19080719 missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19069754 nonsense probably null
R5371:Vmn2r98 UTSW 17 19069753 missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19080899 missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19065998 missense probably benign 0.17
R6155:Vmn2r98 UTSW 17 19065881 missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19065801 missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19065248 missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19066268 missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19080922 missense probably benign
R7068:Vmn2r98 UTSW 17 19065313 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTCTAATCCTCCCCAATGACC -3'
(R):5'- CCACAGCTTAGGAAGATAAACGTC -3'

Sequencing Primer
(F):5'- TAATCCTCCCCAATGACCACAAAGG -3'
(R):5'- ATAAACGTCTTCTGGGTATTTATTGG -3'
Posted On2017-08-16