Incidental Mutation 'R6109:Hdac2'
ID484727
Institutional Source Beutler Lab
Gene Symbol Hdac2
Ensembl Gene ENSMUSG00000019777
Gene Namehistone deacetylase 2
SynonymsYy1bp, D10Wsu179e
MMRRC Submission 044259-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6109 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location36974544-37001889 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36986389 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 83 (D83G)
Ref Sequence ENSEMBL: ENSMUSP00000019911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019911] [ENSMUST00000105510]
Predicted Effect probably null
Transcript: ENSMUST00000019911
AA Change: D83G

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000019911
Gene: ENSMUSG00000019777
AA Change: D83G

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 19 321 2.5e-88 PFAM
low complexity region 392 403 N/A INTRINSIC
low complexity region 418 431 N/A INTRINSIC
low complexity region 448 469 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105510
AA Change: D83G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000101149
Gene: ENSMUSG00000019777
AA Change: D83G

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 19 297 8.9e-75 PFAM
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the histone deacetylase family. Histone deacetylases act via the formation of large multiprotein complexes, and are responsible for the deacetylation of lysine residues at the N-terminal regions of core histones (H2A, H2B, H3 and H4). This protein forms transcriptional repressor complexes by associating with many different proteins, including YY1, a mammalian zinc-finger transcription factor. Thus, it plays an important role in transcriptional regulation, cell cycle progression and developmental events. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and postnatal lethality accompanied with a transient decrease in body size and increase in heart size and cardiomyocyte proliferation that is overcome by 2 months of age in surviving mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T C 19: 11,101,912 M131V possibly damaging Het
Abcc10 T C 17: 46,310,377 Y950C probably benign Het
Acadm A G 3: 153,941,943 C20R probably damaging Het
Agtpbp1 G T 13: 59,473,746 T984K probably damaging Het
Agxt2 C T 15: 10,377,422 T136I probably damaging Het
Ankrd36 C A 11: 5,628,941 N68K probably damaging Het
Ap3b2 T A 7: 81,493,592 D10V possibly damaging Het
Apcdd1 A T 18: 62,937,366 I235F probably damaging Het
Arhgap32 T A 9: 32,260,111 W1396R probably damaging Het
Ascc3 A G 10: 50,649,247 T513A probably benign Het
Aym1 C T 5: 113,357,541 L9F unknown Het
Btnl10 C A 11: 58,920,304 S151Y probably damaging Het
Camk2a A T 18: 60,943,234 K95* probably null Het
Ccdc40 T C 11: 119,231,978 V202A probably benign Het
Cd200r3 T A 16: 44,953,682 D152E probably benign Het
Cd2bp2 C T 7: 127,194,815 D101N probably damaging Het
Cdh20 G A 1: 104,994,014 D679N probably damaging Het
Clpx C T 9: 65,299,952 T44I probably benign Het
Cnnm4 T G 1: 36,498,479 V541G probably damaging Het
Csmd1 T C 8: 16,199,860 I1035V possibly damaging Het
Ctsw T C 19: 5,467,119 S62G probably benign Het
Dlk2 T A 17: 46,301,697 Y109N probably damaging Het
Ebf3 C T 7: 137,206,226 V363M probably damaging Het
Farsb A G 1: 78,463,270 probably null Het
Fastkd3 C T 13: 68,590,218 Q32* probably null Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gk5 C A 9: 96,140,610 F166L probably benign Het
Gm11271 G T 13: 21,381,139 noncoding transcript Het
Gm5294 C A 5: 138,820,095 Q6K probably damaging Het
Gnat2 T A 3: 108,100,135 Y290N probably damaging Het
H2-D1 A T 17: 35,263,937 I148F probably damaging Het
Kdm5d T C Y: 921,501 W500R probably damaging Het
Kel A T 6: 41,688,862 F489I probably benign Het
Kmo C A 1: 175,637,908 A76E possibly damaging Het
Krt32 T C 11: 100,087,965 T88A probably benign Het
Lce3b A G 3: 92,933,687 T30A unknown Het
Lcn11 A G 2: 25,779,296 H155R possibly damaging Het
Lmln T A 16: 33,069,111 I129N possibly damaging Het
Meiob A G 17: 24,813,019 K3E probably benign Het
Mitf C T 6: 97,996,468 T229M probably damaging Het
Muc16 T C 9: 18,655,359 I1955V unknown Het
Naip1 A G 13: 100,427,182 C492R probably damaging Het
Ncor2 C T 5: 125,055,846 A26T probably damaging Het
Ngfr T G 11: 95,578,057 D165A probably damaging Het
Nobox A T 6: 43,305,169 S323R probably damaging Het
Olfr616 T C 7: 103,565,139 I47V probably benign Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Olfr937 A G 9: 39,060,196 S157P probably benign Het
Pcdhb1 G T 18: 37,265,253 V86F possibly damaging Het
Pdk1 A G 2: 71,883,506 E165G probably benign Het
Peak1 C T 9: 56,259,283 V454I probably benign Het
Rad9b C T 5: 122,344,297 G125D probably damaging Het
S100a16 T C 3: 90,542,074 F19L probably damaging Het
Serpine2 T C 1: 79,810,671 K190E probably damaging Het
Slf1 A T 13: 77,126,680 M12K probably damaging Het
Tex101 T C 7: 24,668,313 T205A possibly damaging Het
Tssk5 T C 15: 76,373,716 E147G probably damaging Het
Ubr4 A G 4: 139,417,364 T1495A probably damaging Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Wdr70 A T 15: 8,079,154 probably null Het
Zfp811 T A 17: 32,797,374 probably null Het
Zscan10 T A 17: 23,607,129 F88L probably damaging Het
Other mutations in Hdac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Hdac2 APN 10 36997071 missense probably damaging 1.00
IGL00827:Hdac2 APN 10 36997114 missense probably benign
IGL02971:Hdac2 APN 10 37000374 nonsense probably null
checkmate UTSW 10 36993899 missense probably benign
failure UTSW 10 36989184 missense probably benign 0.16
misstep UTSW 10 36986374 missense possibly damaging 0.59
R0123:Hdac2 UTSW 10 36989184 missense probably benign 0.16
R0134:Hdac2 UTSW 10 36989184 missense probably benign 0.16
R0167:Hdac2 UTSW 10 37000372 missense probably benign 0.04
R0225:Hdac2 UTSW 10 36989184 missense probably benign 0.16
R0455:Hdac2 UTSW 10 36991836 missense probably damaging 1.00
R0480:Hdac2 UTSW 10 36974792 missense probably damaging 1.00
R0482:Hdac2 UTSW 10 36989134 intron probably benign
R0535:Hdac2 UTSW 10 36993899 missense probably benign
R1101:Hdac2 UTSW 10 36991809 missense probably damaging 1.00
R1297:Hdac2 UTSW 10 36986374 missense possibly damaging 0.59
R4839:Hdac2 UTSW 10 36997466 missense probably benign 0.04
R6447:Hdac2 UTSW 10 36993816 missense possibly damaging 0.95
R6519:Hdac2 UTSW 10 36989256 missense probably damaging 1.00
R6893:Hdac2 UTSW 10 36997007 missense probably damaging 1.00
R7461:Hdac2 UTSW 10 36989236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTGATCGTGGAAACTTACAC -3'
(R):5'- AATCCCAAACTTTTCATGGGTGC -3'

Sequencing Primer
(F):5'- CTGATCGTGGAAACTTACACATATC -3'
(R):5'- ACTTTTCATGGGTGCAAAATAAAAAG -3'
Posted On2017-08-16