Incidental Mutation 'R6109:Olfr811'
ID484730
Institutional Source Beutler Lab
Gene Symbol Olfr811
Ensembl Gene ENSMUSG00000063173
Gene Nameolfactory receptor 811
SynonymsMOR110-6, GA_x6K02T2PULF-11481207-11480248
MMRRC Submission 044259-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6109 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location129800615-129804396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 129801821 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 235 (A235S)
Ref Sequence ENSEMBL: ENSMUSP00000149970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076437] [ENSMUST00000215058] [ENSMUST00000217571]
Predicted Effect probably damaging
Transcript: ENSMUST00000076437
AA Change: A235S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075768
Gene: ENSMUSG00000063173
AA Change: A235S

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.1e-51 PFAM
Pfam:7tm_1 39 288 1.5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215058
AA Change: A235S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216283
Predicted Effect probably damaging
Transcript: ENSMUST00000217571
AA Change: A235S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.188 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T C 19: 11,101,912 M131V possibly damaging Het
Abcc10 T C 17: 46,310,377 Y950C probably benign Het
Acadm A G 3: 153,941,943 C20R probably damaging Het
Agtpbp1 G T 13: 59,473,746 T984K probably damaging Het
Agxt2 C T 15: 10,377,422 T136I probably damaging Het
Ankrd36 C A 11: 5,628,941 N68K probably damaging Het
Ap3b2 T A 7: 81,493,592 D10V possibly damaging Het
Apcdd1 A T 18: 62,937,366 I235F probably damaging Het
Arhgap32 T A 9: 32,260,111 W1396R probably damaging Het
Ascc3 A G 10: 50,649,247 T513A probably benign Het
Aym1 C T 5: 113,357,541 L9F unknown Het
Btnl10 C A 11: 58,920,304 S151Y probably damaging Het
Camk2a A T 18: 60,943,234 K95* probably null Het
Ccdc40 T C 11: 119,231,978 V202A probably benign Het
Cd200r3 T A 16: 44,953,682 D152E probably benign Het
Cd2bp2 C T 7: 127,194,815 D101N probably damaging Het
Cdh20 G A 1: 104,994,014 D679N probably damaging Het
Clpx C T 9: 65,299,952 T44I probably benign Het
Cnnm4 T G 1: 36,498,479 V541G probably damaging Het
Csmd1 T C 8: 16,199,860 I1035V possibly damaging Het
Ctsw T C 19: 5,467,119 S62G probably benign Het
Dlk2 T A 17: 46,301,697 Y109N probably damaging Het
Ebf3 C T 7: 137,206,226 V363M probably damaging Het
Farsb A G 1: 78,463,270 probably null Het
Fastkd3 C T 13: 68,590,218 Q32* probably null Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gk5 C A 9: 96,140,610 F166L probably benign Het
Gm11271 G T 13: 21,381,139 noncoding transcript Het
Gm5294 C A 5: 138,820,095 Q6K probably damaging Het
Gnat2 T A 3: 108,100,135 Y290N probably damaging Het
H2-D1 A T 17: 35,263,937 I148F probably damaging Het
Hdac2 A G 10: 36,986,389 D83G probably null Het
Kdm5d T C Y: 921,501 W500R probably damaging Het
Kel A T 6: 41,688,862 F489I probably benign Het
Kmo C A 1: 175,637,908 A76E possibly damaging Het
Krt32 T C 11: 100,087,965 T88A probably benign Het
Lce3b A G 3: 92,933,687 T30A unknown Het
Lcn11 A G 2: 25,779,296 H155R possibly damaging Het
Lmln T A 16: 33,069,111 I129N possibly damaging Het
Meiob A G 17: 24,813,019 K3E probably benign Het
Mitf C T 6: 97,996,468 T229M probably damaging Het
Muc16 T C 9: 18,655,359 I1955V unknown Het
Naip1 A G 13: 100,427,182 C492R probably damaging Het
Ncor2 C T 5: 125,055,846 A26T probably damaging Het
Ngfr T G 11: 95,578,057 D165A probably damaging Het
Nobox A T 6: 43,305,169 S323R probably damaging Het
Olfr616 T C 7: 103,565,139 I47V probably benign Het
Olfr937 A G 9: 39,060,196 S157P probably benign Het
Pcdhb1 G T 18: 37,265,253 V86F possibly damaging Het
Pdk1 A G 2: 71,883,506 E165G probably benign Het
Peak1 C T 9: 56,259,283 V454I probably benign Het
Rad9b C T 5: 122,344,297 G125D probably damaging Het
S100a16 T C 3: 90,542,074 F19L probably damaging Het
Serpine2 T C 1: 79,810,671 K190E probably damaging Het
Slf1 A T 13: 77,126,680 M12K probably damaging Het
Tex101 T C 7: 24,668,313 T205A possibly damaging Het
Tssk5 T C 15: 76,373,716 E147G probably damaging Het
Ubr4 A G 4: 139,417,364 T1495A probably damaging Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Wdr70 A T 15: 8,079,154 probably null Het
Zfp811 T A 17: 32,797,374 probably null Het
Zscan10 T A 17: 23,607,129 F88L probably damaging Het
Other mutations in Olfr811
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Olfr811 APN 10 129801907 missense possibly damaging 0.64
IGL01957:Olfr811 APN 10 129802250 missense probably damaging 1.00
IGL02394:Olfr811 APN 10 129802313 missense possibly damaging 0.90
IGL02451:Olfr811 APN 10 129801833 nonsense probably null
IGL03111:Olfr811 APN 10 129802078 missense probably benign 0.00
IGL03369:Olfr811 APN 10 129802471 missense probably damaging 0.99
R0704:Olfr811 UTSW 10 129802303 missense probably benign 0.01
R1393:Olfr811 UTSW 10 129801932 missense probably benign 0.22
R1941:Olfr811 UTSW 10 129802412 missense probably benign 0.00
R1994:Olfr811 UTSW 10 129801661 missense probably damaging 1.00
R3427:Olfr811 UTSW 10 129801851 missense possibly damaging 0.85
R4296:Olfr811 UTSW 10 129802300 missense probably damaging 0.97
R4937:Olfr811 UTSW 10 129802063 missense probably benign 0.31
R5016:Olfr811 UTSW 10 129801793 missense probably benign 0.01
R5615:Olfr811 UTSW 10 129801767 missense probably damaging 1.00
R5662:Olfr811 UTSW 10 129802307 missense possibly damaging 0.83
R5750:Olfr811 UTSW 10 129801620 missense probably benign 0.01
R6109:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6110:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6110:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6117:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6117:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6119:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6119:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6120:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6120:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6124:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6124:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6395:Olfr811 UTSW 10 129802144 missense probably damaging 1.00
R6440:Olfr811 UTSW 10 129801968 missense probably damaging 1.00
R6559:Olfr811 UTSW 10 129801664 missense probably damaging 1.00
R6707:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6708:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6868:Olfr811 UTSW 10 129802168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAAGCTTCCTTCACCTGC -3'
(R):5'- TTGTGCCTCCAAAACAATAGAC -3'

Sequencing Primer
(F):5'- CACCTGCTGATTCCTTAGGGTG -3'
(R):5'- ATAGACCACTTCCTGTGTGACAG -3'
Posted On2017-08-16