Incidental Mutation 'R6110:Setx'
ID484762
Institutional Source Beutler Lab
Gene Symbol Setx
Ensembl Gene ENSMUSG00000043535
Gene Namesenataxin
SynonymsA930037J23Rik, Als4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6110 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location29124181-29182471 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 29140290 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 247 (I247S)
Ref Sequence ENSEMBL: ENSMUSP00000051492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061578]
Predicted Effect probably damaging
Transcript: ENSMUST00000061578
AA Change: I247S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051492
Gene: ENSMUSG00000043535
AA Change: I247S

DomainStartEndE-ValueType
low complexity region 864 876 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
low complexity region 1058 1079 N/A INTRINSIC
low complexity region 1575 1594 N/A INTRINSIC
Pfam:AAA_11 1909 2194 1.9e-68 PFAM
Pfam:AAA_19 1924 2015 2.9e-11 PFAM
Pfam:AAA_12 2201 2402 1.1e-54 PFAM
low complexity region 2499 2516 N/A INTRINSIC
low complexity region 2576 2587 N/A INTRINSIC
Meta Mutation Damage Score 0.244 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein named for its homology to the Sen1p protein of fungi which has RNA helicase activity encoded by a domain at the C-terminal end of the protein. The protein encoded by this gene contains a DNA/RNA helicase domain at its C-terminal end which suggests that it may be involved in both DNA and RNA processing. Mutations in this gene have been associated with ataxia-ocular apraxia-2 (AOA2) and an autosomal dominant form of juvenile amyotrophic lateral sclerosis (ALS4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility due to arrested male meiosis and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7b T C 4: 56,740,224 E378G probably damaging Het
Adam17 A T 12: 21,353,948 V99E probably damaging Het
Alkal2 G A 12: 30,887,058 R90Q probably damaging Het
Amy1 C T 3: 113,561,900 V309M probably damaging Het
Apob T C 12: 8,011,883 L3455P probably damaging Het
Ash1l T A 3: 88,985,129 H1438Q probably damaging Het
BC024139 A G 15: 76,119,796 S757P probably benign Het
Btd G A 14: 31,641,108 probably benign Het
C2cd3 T A 7: 100,441,076 F462Y probably damaging Het
C4bp T A 1: 130,639,072 K177* probably null Het
Cacna1h G T 17: 25,391,276 P752Q probably benign Het
Cd34 G A 1: 194,949,569 probably null Het
Clptm1 G A 7: 19,633,806 probably benign Het
Dip2c T C 13: 9,623,766 S1081P probably damaging Het
Dnm3 CAGCCTTCGTTGGGTG C 1: 162,011,068 probably benign Het
Efcab6 T G 15: 83,879,634 M1166L possibly damaging Het
Fam151a G A 4: 106,748,198 V586M probably damaging Het
Fap T G 2: 62,554,770 Y54S possibly damaging Het
Gm17727 A T 9: 35,777,146 S48T possibly damaging Het
Grhl1 A G 12: 24,580,747 probably null Het
Hcrtr2 T C 9: 76,259,782 Y91C probably damaging Het
Kat6b C T 14: 21,670,487 R1745C probably damaging Het
Kdm5a T C 6: 120,412,306 L898P probably damaging Het
Lipo5 T C 19: 33,467,917 Q84R unknown Het
Mfn1 G A 3: 32,563,024 M18I probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Mtfmt T C 9: 65,447,304 probably null Het
Nsun2 C G 13: 69,627,648 Q404E probably benign Het
Odf3 G T 7: 140,848,641 R73L possibly damaging Het
Olfr1052 T A 2: 86,298,675 N286K probably damaging Het
Olfr1487 C T 19: 13,619,885 A241V probably benign Het
Olfr346 T C 2: 36,688,547 S182P probably benign Het
Olfr495 G T 7: 108,395,828 S236I possibly damaging Het
Olfr520 C T 7: 99,735,170 S9L possibly damaging Het
Olfr646 A G 7: 104,106,572 M98V probably damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Parp9 A G 16: 35,953,626 I90V possibly damaging Het
Pax2 T A 19: 44,790,736 S183T probably damaging Het
Pcdha11 T C 18: 37,011,456 L200P probably damaging Het
Pcdhb4 T C 18: 37,308,429 V264A possibly damaging Het
Plch1 G T 3: 63,698,858 N1199K possibly damaging Het
Ptpn22 A G 3: 103,912,015 N795S probably damaging Het
Qars T C 9: 108,508,098 S6P probably benign Het
Sema3a T C 5: 13,581,001 Y502H probably damaging Het
Sema4f A G 6: 82,937,104 I91T probably damaging Het
Slc9c1 T C 16: 45,575,368 L594P probably damaging Het
Tnfrsf19 A T 14: 60,971,139 M311K probably benign Het
Ttc30b T C 2: 75,937,800 Y203C probably damaging Het
Tubgcp4 T C 2: 121,194,108 I588T probably benign Het
Tyro3 T C 2: 119,812,823 V655A probably damaging Het
Uba7 T A 9: 107,978,939 D504E probably benign Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Vldlr A G 19: 27,238,077 E117G possibly damaging Het
Vmn2r44 A T 7: 8,378,006 I296K probably damaging Het
Vmn2r80 T A 10: 79,182,003 C521S probably damaging Het
Wnk1 A T 6: 119,972,997 probably benign Het
Xpo1 T C 11: 23,287,434 S766P probably damaging Het
Zcchc4 A G 5: 52,796,144 N165S possibly damaging Het
Other mutations in Setx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Setx APN 2 29148445 missense possibly damaging 0.50
IGL00806:Setx APN 2 29127026 missense probably damaging 1.00
IGL01346:Setx APN 2 29144809 missense probably damaging 1.00
IGL01623:Setx APN 2 29163009 missense possibly damaging 0.70
IGL02351:Setx APN 2 29146964 missense probably benign 0.45
IGL02358:Setx APN 2 29146964 missense probably benign 0.45
IGL02378:Setx APN 2 29173726 splice site probably benign
IGL02388:Setx APN 2 29173653 missense probably damaging 1.00
IGL02408:Setx APN 2 29133930 missense probably damaging 1.00
IGL02425:Setx APN 2 29148408 missense probably benign 0.00
IGL03023:Setx APN 2 29145902 missense probably benign 0.02
IGL03351:Setx APN 2 29161799 missense probably benign 0.25
addison UTSW 2 29158905 missense probably damaging 1.00
dallas UTSW 2 29154061 frame shift probably null
denton UTSW 2 29145060 missense possibly damaging 0.81
doggie UTSW 2 29164550 missense probably damaging 1.00
Irving UTSW 2 29139221 missense probably damaging 0.99
IGL03014:Setx UTSW 2 29139411 missense probably damaging 1.00
PIT4403001:Setx UTSW 2 29133955 missense probably damaging 1.00
R0027:Setx UTSW 2 29139221 missense probably damaging 0.99
R0031:Setx UTSW 2 29176929 missense probably benign 0.02
R0070:Setx UTSW 2 29161525 missense probably benign 0.00
R0070:Setx UTSW 2 29161525 missense probably benign 0.00
R0092:Setx UTSW 2 29146293 missense probably benign 0.00
R0193:Setx UTSW 2 29179673 missense probably benign 0.21
R0281:Setx UTSW 2 29179643 missense probably benign 0.00
R0401:Setx UTSW 2 29166289 nonsense probably null
R0413:Setx UTSW 2 29139278 missense probably damaging 1.00
R0517:Setx UTSW 2 29157133 missense probably benign 0.00
R0536:Setx UTSW 2 29158248 missense possibly damaging 0.46
R0617:Setx UTSW 2 29146807 missense possibly damaging 0.86
R1183:Setx UTSW 2 29180092 missense probably benign
R1331:Setx UTSW 2 29179686 missense probably benign
R1465:Setx UTSW 2 29140389 critical splice donor site probably null
R1465:Setx UTSW 2 29140389 critical splice donor site probably null
R1467:Setx UTSW 2 29158905 missense probably damaging 1.00
R1467:Setx UTSW 2 29158905 missense probably damaging 1.00
R1482:Setx UTSW 2 29162992 missense probably damaging 0.99
R1599:Setx UTSW 2 29140373 missense probably benign 0.04
R1663:Setx UTSW 2 29126905 missense probably damaging 1.00
R1909:Setx UTSW 2 29163009 missense possibly damaging 0.70
R2117:Setx UTSW 2 29130301 missense probably benign 0.01
R2207:Setx UTSW 2 29154061 frame shift probably null
R2221:Setx UTSW 2 29154061 frame shift probably null
R2223:Setx UTSW 2 29148537 missense possibly damaging 0.89
R2223:Setx UTSW 2 29154061 frame shift probably null
R2273:Setx UTSW 2 29154061 frame shift probably null
R2274:Setx UTSW 2 29154061 frame shift probably null
R2275:Setx UTSW 2 29154061 frame shift probably null
R2309:Setx UTSW 2 29158904 missense probably damaging 1.00
R2328:Setx UTSW 2 29154060 frame shift probably null
R2328:Setx UTSW 2 29154061 frame shift probably null
R2329:Setx UTSW 2 29154061 frame shift probably null
R2331:Setx UTSW 2 29154061 frame shift probably null
R2332:Setx UTSW 2 29154061 frame shift probably null
R2429:Setx UTSW 2 29179898 missense probably benign 0.00
R2438:Setx UTSW 2 29154061 frame shift probably null
R2439:Setx UTSW 2 29154061 frame shift probably null
R2496:Setx UTSW 2 29144801 missense probably benign 0.11
R2858:Setx UTSW 2 29154061 frame shift probably null
R2859:Setx UTSW 2 29154061 frame shift probably null
R2884:Setx UTSW 2 29148625 missense probably damaging 0.98
R2885:Setx UTSW 2 29148625 missense probably damaging 0.98
R2886:Setx UTSW 2 29148625 missense probably damaging 0.98
R2915:Setx UTSW 2 29172324 missense probably damaging 0.99
R2921:Setx UTSW 2 29154060 small deletion probably benign
R2921:Setx UTSW 2 29154061 frame shift probably null
R2923:Setx UTSW 2 29154061 frame shift probably null
R3426:Setx UTSW 2 29154061 frame shift probably null
R3609:Setx UTSW 2 29154061 frame shift probably null
R3610:Setx UTSW 2 29154061 frame shift probably null
R3731:Setx UTSW 2 29154061 frame shift probably null
R3813:Setx UTSW 2 29154061 frame shift probably null
R3835:Setx UTSW 2 29145060 missense possibly damaging 0.81
R3871:Setx UTSW 2 29145741 missense probably damaging 0.98
R4013:Setx UTSW 2 29154061 frame shift probably null
R4014:Setx UTSW 2 29154061 frame shift probably null
R4015:Setx UTSW 2 29154061 frame shift probably null
R4017:Setx UTSW 2 29154061 frame shift probably null
R4246:Setx UTSW 2 29154061 frame shift probably null
R4248:Setx UTSW 2 29154061 frame shift probably null
R4297:Setx UTSW 2 29154061 frame shift probably null
R4298:Setx UTSW 2 29154061 frame shift probably null
R4539:Setx UTSW 2 29179748 missense probably benign 0.14
R4590:Setx UTSW 2 29144809 missense probably damaging 1.00
R4632:Setx UTSW 2 29148615 missense probably benign 0.23
R4782:Setx UTSW 2 29144046 missense probably damaging 0.99
R4801:Setx UTSW 2 29146373 missense probably benign 0.14
R4802:Setx UTSW 2 29146373 missense probably benign 0.14
R4975:Setx UTSW 2 29164550 missense probably damaging 1.00
R5040:Setx UTSW 2 29139338 missense probably damaging 1.00
R5133:Setx UTSW 2 29180081 missense probably benign 0.02
R5208:Setx UTSW 2 29166367 missense possibly damaging 0.63
R5237:Setx UTSW 2 29146983 missense probably benign 0.00
R5248:Setx UTSW 2 29148418 missense probably benign 0.26
R5288:Setx UTSW 2 29134033 critical splice donor site probably null
R5385:Setx UTSW 2 29134033 critical splice donor site probably null
R5387:Setx UTSW 2 29147594 missense probably benign 0.00
R5407:Setx UTSW 2 29145474 missense probably benign 0.00
R5685:Setx UTSW 2 29171280 missense probably damaging 1.00
R6136:Setx UTSW 2 29148027 missense probably benign 0.01
R6310:Setx UTSW 2 29176935 missense possibly damaging 0.57
R6328:Setx UTSW 2 29174462 intron probably benign
R6358:Setx UTSW 2 29171348 missense possibly damaging 0.79
R6384:Setx UTSW 2 29173558 missense probably damaging 1.00
R6400:Setx UTSW 2 29130274 missense probably damaging 0.97
R6572:Setx UTSW 2 29173694 missense possibly damaging 0.63
R6662:Setx UTSW 2 29158114 missense probably damaging 0.97
R6898:Setx UTSW 2 29148108 missense probably benign 0.00
R7188:Setx UTSW 2 29148172 missense probably benign 0.02
R7332:Setx UTSW 2 29146626 missense probably benign 0.00
R7357:Setx UTSW 2 29130301 missense probably benign 0.01
X0066:Setx UTSW 2 29147879 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCATCACTTAACTGTTTTCCAGAGA -3'
(R):5'- TCTGCCTAGTGACACCAACATT -3'

Sequencing Primer
(F):5'- TTCCAGAGAAAATGTCAAGTGC -3'
(R):5'- CCTAGTGACACCAACATTTTTAAAAG -3'
Posted On2017-08-16