Incidental Mutation 'R6110:Actl7b'
ID484775
Institutional Source Beutler Lab
Gene Symbol Actl7b
Ensembl Gene ENSMUSG00000070980
Gene Nameactin-like 7b
SynonymsENSMUSG00000070980, Tact1, t-actin 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6110 (G1)
Quality Score203.009
Status Validated
Chromosome4
Chromosomal Location56740005-56741443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56740224 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 378 (E378G)
Ref Sequence ENSEMBL: ENSMUSP00000092693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095079] [ENSMUST00000095080] [ENSMUST00000181745]
Predicted Effect probably benign
Transcript: ENSMUST00000095079
SMART Domains Protein: ENSMUSP00000092692
Gene: ENSMUSG00000070979

DomainStartEndE-ValueType
Pfam:ACTL7A_N 6 70 1.3e-39 PFAM
ACTIN 74 440 4.63e-123 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095080
AA Change: E378G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092693
Gene: ENSMUSG00000070980
AA Change: E378G

DomainStartEndE-ValueType
ACTIN 51 418 1.6e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181745
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of actin-related proteins (ARPs) which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene (ACTL7B), and related gene, ACTL7A, are intronless, and are located approximately 4 kb apart in a head-to-head orientation within the familial dysautonomia candidate region on 9q31. Based on mutational analysis of the ACTL7B gene in patients with this disorder, it was concluded that it is unlikely to be involved in the pathogenesis of dysautonomia. Unlike ACTL7A, the ACTL7B gene is expressed predominantly in the testis, however, its exact function is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 A T 12: 21,353,948 V99E probably damaging Het
Alkal2 G A 12: 30,887,058 R90Q probably damaging Het
Amy1 C T 3: 113,561,900 V309M probably damaging Het
Apob T C 12: 8,011,883 L3455P probably damaging Het
Ash1l T A 3: 88,985,129 H1438Q probably damaging Het
BC024139 A G 15: 76,119,796 S757P probably benign Het
Btd G A 14: 31,641,108 probably benign Het
C2cd3 T A 7: 100,441,076 F462Y probably damaging Het
C4bp T A 1: 130,639,072 K177* probably null Het
Cacna1h G T 17: 25,391,276 P752Q probably benign Het
Cd34 G A 1: 194,949,569 probably null Het
Clptm1 G A 7: 19,633,806 probably benign Het
Dip2c T C 13: 9,623,766 S1081P probably damaging Het
Dnm3 CAGCCTTCGTTGGGTG C 1: 162,011,068 probably benign Het
Efcab6 T G 15: 83,879,634 M1166L possibly damaging Het
Fam151a G A 4: 106,748,198 V586M probably damaging Het
Fap T G 2: 62,554,770 Y54S possibly damaging Het
Gm17727 A T 9: 35,777,146 S48T possibly damaging Het
Grhl1 A G 12: 24,580,747 probably null Het
Hcrtr2 T C 9: 76,259,782 Y91C probably damaging Het
Kat6b C T 14: 21,670,487 R1745C probably damaging Het
Kdm5a T C 6: 120,412,306 L898P probably damaging Het
Lipo5 T C 19: 33,467,917 Q84R unknown Het
Mfn1 G A 3: 32,563,024 M18I probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Mtfmt T C 9: 65,447,304 probably null Het
Nsun2 C G 13: 69,627,648 Q404E probably benign Het
Odf3 G T 7: 140,848,641 R73L possibly damaging Het
Olfr1052 T A 2: 86,298,675 N286K probably damaging Het
Olfr1487 C T 19: 13,619,885 A241V probably benign Het
Olfr346 T C 2: 36,688,547 S182P probably benign Het
Olfr495 G T 7: 108,395,828 S236I possibly damaging Het
Olfr520 C T 7: 99,735,170 S9L possibly damaging Het
Olfr646 A G 7: 104,106,572 M98V probably damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Parp9 A G 16: 35,953,626 I90V possibly damaging Het
Pax2 T A 19: 44,790,736 S183T probably damaging Het
Pcdha11 T C 18: 37,011,456 L200P probably damaging Het
Pcdhb4 T C 18: 37,308,429 V264A possibly damaging Het
Plch1 G T 3: 63,698,858 N1199K possibly damaging Het
Ptpn22 A G 3: 103,912,015 N795S probably damaging Het
Qars T C 9: 108,508,098 S6P probably benign Het
Sema3a T C 5: 13,581,001 Y502H probably damaging Het
Sema4f A G 6: 82,937,104 I91T probably damaging Het
Setx T G 2: 29,140,290 I247S probably damaging Het
Slc9c1 T C 16: 45,575,368 L594P probably damaging Het
Tnfrsf19 A T 14: 60,971,139 M311K probably benign Het
Ttc30b T C 2: 75,937,800 Y203C probably damaging Het
Tubgcp4 T C 2: 121,194,108 I588T probably benign Het
Tyro3 T C 2: 119,812,823 V655A probably damaging Het
Uba7 T A 9: 107,978,939 D504E probably benign Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Vldlr A G 19: 27,238,077 E117G possibly damaging Het
Vmn2r44 A T 7: 8,378,006 I296K probably damaging Het
Vmn2r80 T A 10: 79,182,003 C521S probably damaging Het
Wnk1 A T 6: 119,972,997 probably benign Het
Xpo1 T C 11: 23,287,434 S766P probably damaging Het
Zcchc4 A G 5: 52,796,144 N165S possibly damaging Het
Other mutations in Actl7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01514:Actl7b APN 4 56740677 missense probably damaging 1.00
IGL02252:Actl7b APN 4 56741205 missense probably damaging 0.97
IGL02927:Actl7b APN 4 56740609 missense probably damaging 1.00
IGL03370:Actl7b APN 4 56741173 missense probably damaging 1.00
R0294:Actl7b UTSW 4 56740848 missense possibly damaging 0.83
R1711:Actl7b UTSW 4 56740165 nonsense probably null
R4773:Actl7b UTSW 4 56740972 missense probably benign
R6423:Actl7b UTSW 4 56741213 missense probably benign 0.03
R7039:Actl7b UTSW 4 56741022 missense probably damaging 0.98
R7250:Actl7b UTSW 4 56741035 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCTGTAAAGGTATAGAGTGGCCC -3'
(R):5'- CTGCTCTGAGATGCTCTTCAAG -3'

Sequencing Primer
(F):5'- GTATAGAGTGGCCCAAAGAGG -3'
(R):5'- TTCAAGCCCTCCCTGGTGG -3'
Posted On2017-08-16