Incidental Mutation 'R6110:Kdm5a'
ID484780
Institutional Source Beutler Lab
Gene Symbol Kdm5a
Ensembl Gene ENSMUSG00000030180
Gene Namelysine (K)-specific demethylase 5A
SynonymsJarid1a, Rbbp2, RBP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6110 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location120364124-120444574 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120412306 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 898 (L898P)
Ref Sequence ENSEMBL: ENSMUSP00000005108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005108] [ENSMUST00000132009] [ENSMUST00000135802]
Predicted Effect probably damaging
Transcript: ENSMUST00000005108
AA Change: L898P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005108
Gene: ENSMUSG00000030180
AA Change: L898P

DomainStartEndE-ValueType
JmjN 18 59 4.06e-20 SMART
ARID 81 170 4.76e-35 SMART
BRIGHT 85 175 2.48e-31 SMART
PHD 295 341 1.16e-14 SMART
Blast:JmjC 384 436 2e-22 BLAST
JmjC 437 603 5.88e-73 SMART
low complexity region 638 651 N/A INTRINSIC
Pfam:zf-C5HC2 676 729 1.3e-21 PFAM
Pfam:PLU-1 740 1072 1.2e-104 PFAM
low complexity region 1091 1119 N/A INTRINSIC
PHD 1163 1216 1.37e-11 SMART
low complexity region 1269 1280 N/A INTRINSIC
low complexity region 1337 1351 N/A INTRINSIC
low complexity region 1403 1414 N/A INTRINSIC
low complexity region 1494 1512 N/A INTRINSIC
coiled coil region 1534 1579 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124847
Predicted Effect probably benign
Transcript: ENSMUST00000132009
SMART Domains Protein: ENSMUSP00000145375
Gene: ENSMUSG00000030180

DomainStartEndE-ValueType
JmjN 18 59 4.06e-20 SMART
ARID 81 170 4.76e-35 SMART
BRIGHT 85 175 2.48e-31 SMART
PHD 295 341 1.16e-14 SMART
JmjC 437 603 1.47e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135802
SMART Domains Protein: ENSMUSP00000145021
Gene: ENSMUSG00000030180

DomainStartEndE-ValueType
JmjN 18 59 1.7e-22 SMART
ARID 81 170 3.6e-39 SMART
BRIGHT 85 175 1.2e-33 SMART
PHD 295 341 7.3e-17 SMART
Blast:JmjC 384 436 2e-22 BLAST
JmjC 437 603 2.2e-75 SMART
low complexity region 638 651 N/A INTRINSIC
Pfam:zf-C5HC2 676 728 6.3e-15 PFAM
Pfam:PLU-1 741 811 9.8e-16 PFAM
Meta Mutation Damage Score 0.28 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Jumonji, AT-rich interactive domain 1 (JARID1) histone demethylase protein family. The encoded protein plays a role in gene regulation through the histone code by specifically demethylating lysine 4 of histone H3. The encoded protein interacts with many other proteins, including retinoblastoma protein, and is implicated in the transcriptional regulation of Hox genes and cytokines. This gene may play a role in tumor progression. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body size, abnormal involuntary movement and quantitative changes in the hematopoietic stem cell and myeloid progenitor compartments, consistent with enhanced survival and increased cycling. Neonatalsurvival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7b T C 4: 56,740,224 E378G probably damaging Het
Adam17 A T 12: 21,353,948 V99E probably damaging Het
Alkal2 G A 12: 30,887,058 R90Q probably damaging Het
Amy1 C T 3: 113,561,900 V309M probably damaging Het
Apob T C 12: 8,011,883 L3455P probably damaging Het
Ash1l T A 3: 88,985,129 H1438Q probably damaging Het
BC024139 A G 15: 76,119,796 S757P probably benign Het
Btd G A 14: 31,641,108 probably benign Het
C2cd3 T A 7: 100,441,076 F462Y probably damaging Het
C4bp T A 1: 130,639,072 K177* probably null Het
Cacna1h G T 17: 25,391,276 P752Q probably benign Het
Cd34 G A 1: 194,949,569 probably null Het
Clptm1 G A 7: 19,633,806 probably benign Het
Dip2c T C 13: 9,623,766 S1081P probably damaging Het
Dnm3 CAGCCTTCGTTGGGTG C 1: 162,011,068 probably benign Het
Efcab6 T G 15: 83,879,634 M1166L possibly damaging Het
Fam151a G A 4: 106,748,198 V586M probably damaging Het
Fap T G 2: 62,554,770 Y54S possibly damaging Het
Gm17727 A T 9: 35,777,146 S48T possibly damaging Het
Grhl1 A G 12: 24,580,747 probably null Het
Hcrtr2 T C 9: 76,259,782 Y91C probably damaging Het
Kat6b C T 14: 21,670,487 R1745C probably damaging Het
Lipo5 T C 19: 33,467,917 Q84R unknown Het
Mfn1 G A 3: 32,563,024 M18I probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Mtfmt T C 9: 65,447,304 probably null Het
Nsun2 C G 13: 69,627,648 Q404E probably benign Het
Odf3 G T 7: 140,848,641 R73L possibly damaging Het
Olfr1052 T A 2: 86,298,675 N286K probably damaging Het
Olfr1487 C T 19: 13,619,885 A241V probably benign Het
Olfr346 T C 2: 36,688,547 S182P probably benign Het
Olfr495 G T 7: 108,395,828 S236I possibly damaging Het
Olfr520 C T 7: 99,735,170 S9L possibly damaging Het
Olfr646 A G 7: 104,106,572 M98V probably damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Parp9 A G 16: 35,953,626 I90V possibly damaging Het
Pax2 T A 19: 44,790,736 S183T probably damaging Het
Pcdha11 T C 18: 37,011,456 L200P probably damaging Het
Pcdhb4 T C 18: 37,308,429 V264A possibly damaging Het
Plch1 G T 3: 63,698,858 N1199K possibly damaging Het
Ptpn22 A G 3: 103,912,015 N795S probably damaging Het
Qars T C 9: 108,508,098 S6P probably benign Het
Sema3a T C 5: 13,581,001 Y502H probably damaging Het
Sema4f A G 6: 82,937,104 I91T probably damaging Het
Setx T G 2: 29,140,290 I247S probably damaging Het
Slc9c1 T C 16: 45,575,368 L594P probably damaging Het
Tnfrsf19 A T 14: 60,971,139 M311K probably benign Het
Ttc30b T C 2: 75,937,800 Y203C probably damaging Het
Tubgcp4 T C 2: 121,194,108 I588T probably benign Het
Tyro3 T C 2: 119,812,823 V655A probably damaging Het
Uba7 T A 9: 107,978,939 D504E probably benign Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Vldlr A G 19: 27,238,077 E117G possibly damaging Het
Vmn2r44 A T 7: 8,378,006 I296K probably damaging Het
Vmn2r80 T A 10: 79,182,003 C521S probably damaging Het
Wnk1 A T 6: 119,972,997 probably benign Het
Xpo1 T C 11: 23,287,434 S766P probably damaging Het
Zcchc4 A G 5: 52,796,144 N165S possibly damaging Het
Other mutations in Kdm5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Kdm5a APN 6 120385719 critical splice donor site probably null 0.00
IGL00706:Kdm5a APN 6 120406636 missense possibly damaging 0.44
IGL01361:Kdm5a APN 6 120399016 missense probably damaging 1.00
IGL01402:Kdm5a APN 6 120390679 nonsense probably null 0.00
IGL01924:Kdm5a APN 6 120394255 critical splice donor site probably null 0.00
IGL01935:Kdm5a APN 6 120408323 missense probably benign 0.02
IGL02165:Kdm5a APN 6 120415290 missense probably damaging 1.00
IGL02472:Kdm5a APN 6 120406730 splice site probably benign
IGL02506:Kdm5a APN 6 120432149 missense probably damaging 0.99
IGL02604:Kdm5a APN 6 120431980 missense probably benign
IGL02633:Kdm5a APN 6 120364719 missense probably damaging 1.00
IGL02876:Kdm5a APN 6 120390644 unclassified probably benign
IGL03009:Kdm5a APN 6 120430086 missense probably damaging 0.98
IGL03027:Kdm5a APN 6 120374990 splice site probably null
IGL03164:Kdm5a APN 6 120439019 missense probably damaging 1.00
IGL03236:Kdm5a APN 6 120438988 missense probably damaging 0.98
IGL03276:Kdm5a APN 6 120402708 splice site probably benign
Augmented UTSW 6 120430016 intron probably benign
calla_lily UTSW 6 120405022 missense probably damaging 1.00
crocus UTSW 6 120399038 missense probably null 0.98
Magnolia UTSW 6 120398978 missense probably damaging 0.99
Selbst UTSW 6 120388105 nonsense probably null
R0320:Kdm5a UTSW 6 120389620 missense probably benign 0.19
R0462:Kdm5a UTSW 6 120402600 missense probably damaging 1.00
R0601:Kdm5a UTSW 6 120402671 missense possibly damaging 0.76
R0628:Kdm5a UTSW 6 120415239 missense probably damaging 1.00
R1024:Kdm5a UTSW 6 120399038 missense probably null 0.98
R2013:Kdm5a UTSW 6 120431990 missense probably benign 0.09
R2015:Kdm5a UTSW 6 120431990 missense probably benign 0.09
R2061:Kdm5a UTSW 6 120381617 missense probably benign
R2188:Kdm5a UTSW 6 120406640 missense possibly damaging 0.59
R3923:Kdm5a UTSW 6 120381664 missense probably benign 0.01
R4013:Kdm5a UTSW 6 120394106 missense probably damaging 1.00
R4016:Kdm5a UTSW 6 120394106 missense probably damaging 1.00
R4017:Kdm5a UTSW 6 120394106 missense probably damaging 1.00
R4030:Kdm5a UTSW 6 120405113 nonsense probably null
R4646:Kdm5a UTSW 6 120374977 missense possibly damaging 0.55
R4737:Kdm5a UTSW 6 120406015 intron probably benign
R4779:Kdm5a UTSW 6 120369099 unclassified probably benign
R4836:Kdm5a UTSW 6 120412402 missense probably damaging 1.00
R5129:Kdm5a UTSW 6 120405022 missense probably damaging 1.00
R5182:Kdm5a UTSW 6 120388105 nonsense probably null
R5183:Kdm5a UTSW 6 120430016 intron probably benign
R5572:Kdm5a UTSW 6 120412375 missense possibly damaging 0.69
R6132:Kdm5a UTSW 6 120374931 missense probably damaging 1.00
R6198:Kdm5a UTSW 6 120438997 missense probably benign 0.37
R6246:Kdm5a UTSW 6 120431910 missense probably damaging 0.97
R6336:Kdm5a UTSW 6 120398978 missense probably damaging 0.99
R6343:Kdm5a UTSW 6 120382933 missense probably benign 0.01
R6612:Kdm5a UTSW 6 120430228 missense probably damaging 0.99
R6647:Kdm5a UTSW 6 120412461 missense probably benign 0.25
R7068:Kdm5a UTSW 6 120430215 missense probably benign 0.40
R7369:Kdm5a UTSW 6 120432004 missense possibly damaging 0.67
R7380:Kdm5a UTSW 6 120405918 missense probably benign 0.35
R7411:Kdm5a UTSW 6 120426815 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGGTGAGACTGTAGGAGAATAG -3'
(R):5'- TCTTCCCATCGTTCAGAGACTG -3'

Sequencing Primer
(F):5'- TTAGTAGTAACACTGGGGATCAAACC -3'
(R):5'- TCCCATCGTTCAGAGACTGTAAGG -3'
Posted On2017-08-16