Incidental Mutation 'R6111:Ttll4'
ID484819
Institutional Source Beutler Lab
Gene Symbol Ttll4
Ensembl Gene ENSMUSG00000033257
Gene Nametubulin tyrosine ligase-like family, member 4
Synonyms4632407P03Rik
MMRRC Submission 044260-MU
Accession Numbers

Genbank: NM_001014974.1; Ensembl: ENSMUST00000042125

Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R6111 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location74661745-74703730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74697539 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 1141 (K1141M)
Ref Sequence ENSEMBL: ENSMUSP00000037406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042125] [ENSMUST00000113678]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042125
AA Change: K1141M

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000037406
Gene: ENSMUSG00000033257
AA Change: K1141M

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 645 940 2.2e-106 PFAM
low complexity region 942 961 N/A INTRINSIC
low complexity region 1103 1113 N/A INTRINSIC
low complexity region 1168 1182 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113678
AA Change: K1077M
SMART Domains Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257
AA Change: K1077M

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 636 876 3.4e-82 PFAM
low complexity region 878 897 N/A INTRINSIC
low complexity region 1039 1049 N/A INTRINSIC
low complexity region 1104 1118 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145132
Meta Mutation Damage Score 0.0532 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (57/58)
Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik T C 14: 32,806,798 I40T possibly damaging Het
2210408I21Rik A G 13: 77,327,902 E1110G possibly damaging Het
Abcd4 G A 12: 84,615,114 T79I probably damaging Het
Acd A G 8: 105,698,287 M407T probably benign Het
Adcy2 T A 13: 68,729,241 H460L probably damaging Het
Arntl2 T C 6: 146,820,599 F223L probably benign Het
Atad2 G A 15: 58,108,091 H752Y probably benign Het
Camsap2 A G 1: 136,281,298 S819P probably benign Het
Col24a1 C A 3: 145,314,054 T62K probably damaging Het
Cpne6 G A 14: 55,514,634 V283M probably benign Het
D630003M21Rik A G 2: 158,213,448 S590P probably damaging Het
Daam1 T A 12: 71,942,264 M146K unknown Het
Dclk2 A G 3: 86,805,661 Y495H probably benign Het
Ddx4 A T 13: 112,621,232 C330* probably null Het
Dlec1 T C 9: 119,102,624 L37P possibly damaging Het
Dock2 G A 11: 34,708,787 P322S probably damaging Het
Espl1 A G 15: 102,299,888 E443G probably damaging Het
Eya4 T A 10: 23,140,055 D338V possibly damaging Het
Fcmr A G 1: 130,877,829 I267V probably damaging Het
Gfra3 T A 18: 34,690,874 H349L probably damaging Het
Gm25747 A G 12: 113,429,083 probably benign Het
Gria4 G A 9: 4,502,430 R368C probably damaging Het
H2-Q5 A T 17: 35,394,909 I145F possibly damaging Het
Hace1 A T 10: 45,589,510 K54I possibly damaging Het
Ift122 T A 6: 115,875,286 I79N probably damaging Het
Ino80b A G 6: 83,124,366 V121A probably damaging Het
Kcnq1 A G 7: 143,107,737 T63A probably benign Het
Map4k4 C A 1: 40,011,662 Q762K probably benign Het
Mios G A 6: 8,214,836 A11T probably benign Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Notch2 T C 3: 98,146,293 S2091P probably benign Het
Nudt19 T A 7: 35,555,527 D93V probably benign Het
Olfr875 T C 9: 37,772,932 I91T probably damaging Het
Osbpl2 A G 2: 180,150,201 T233A probably benign Het
P3h1 C T 4: 119,241,132 R369* probably null Het
Pcdhb3 A T 18: 37,302,189 I403L probably benign Het
Pigo T C 4: 43,019,724 D935G probably benign Het
Plpp1 A G 13: 112,866,917 H224R probably damaging Het
Rai1 T A 11: 60,187,906 M932K probably damaging Het
Rexo2 A T 9: 48,473,112 F122L probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Sdc3 A G 4: 130,818,842 T77A unknown Het
Skint5 T C 4: 113,705,648 T786A unknown Het
Smok3c C A 5: 138,065,103 P284Q probably damaging Het
Spg11 A G 2: 122,093,482 V786A probably damaging Het
Tnfrsf10b T A 14: 69,782,558 C380S possibly damaging Het
Tsen54 T C 11: 115,820,130 V176A possibly damaging Het
Ttpa A T 4: 20,014,772 I116F probably damaging Het
Tubgcp6 T C 15: 89,100,920 D1655G possibly damaging Het
Usp38 A G 8: 81,013,922 V172A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Wdr72 T C 9: 74,210,325 M773T probably benign Het
Xirp2 T A 2: 67,511,817 H1467Q possibly damaging Het
Zdhhc8 G T 16: 18,224,898 S479R probably damaging Het
Zfp423 A G 8: 87,782,687 V322A probably damaging Het
Zfp72 T G 13: 74,372,385 E191D probably benign Het
Zfp933 T C 4: 147,828,760 T14A probably damaging Het
Other mutations in Ttll4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Ttll4 APN 1 74685893 missense probably damaging 1.00
IGL01743:Ttll4 APN 1 74688193 missense possibly damaging 0.63
IGL01914:Ttll4 APN 1 74679058 missense probably benign 0.01
IGL02288:Ttll4 APN 1 74679401 missense probably benign 0.05
IGL02621:Ttll4 APN 1 74687484 missense probably damaging 1.00
IGL02662:Ttll4 APN 1 74687231 unclassified probably null
IGL02890:Ttll4 APN 1 74687339 nonsense probably null
IGL02937:Ttll4 APN 1 74679503 missense possibly damaging 0.92
IGL03178:Ttll4 APN 1 74680408 missense probably damaging 0.96
IGL03412:Ttll4 APN 1 74687321 missense probably benign 0.28
1mM(1):Ttll4 UTSW 1 74689980 missense probably null 1.00
R0083:Ttll4 UTSW 1 74679769 missense probably benign 0.13
R0108:Ttll4 UTSW 1 74679769 missense probably benign 0.13
R0135:Ttll4 UTSW 1 74679928 missense possibly damaging 0.86
R0137:Ttll4 UTSW 1 74679692 missense possibly damaging 0.74
R0306:Ttll4 UTSW 1 74696757 missense probably benign 0.28
R0506:Ttll4 UTSW 1 74688618 missense probably benign 0.06
R0555:Ttll4 UTSW 1 74688280 missense probably damaging 1.00
R1617:Ttll4 UTSW 1 74679401 missense probably benign 0.05
R1649:Ttll4 UTSW 1 74697470 missense possibly damaging 0.52
R1793:Ttll4 UTSW 1 74687840 missense possibly damaging 0.91
R1898:Ttll4 UTSW 1 74697482 missense probably benign 0.01
R1952:Ttll4 UTSW 1 74687559 missense probably damaging 0.99
R1987:Ttll4 UTSW 1 74685368 missense possibly damaging 0.81
R1989:Ttll4 UTSW 1 74685368 missense possibly damaging 0.81
R2067:Ttll4 UTSW 1 74680382 missense possibly damaging 0.94
R2162:Ttll4 UTSW 1 74686391 missense probably damaging 1.00
R2185:Ttll4 UTSW 1 74679829 missense possibly damaging 0.54
R2875:Ttll4 UTSW 1 74686438 unclassified probably null
R2876:Ttll4 UTSW 1 74686438 unclassified probably null
R2895:Ttll4 UTSW 1 74685358 missense possibly damaging 0.92
R2896:Ttll4 UTSW 1 74685358 missense possibly damaging 0.92
R3157:Ttll4 UTSW 1 74697611 missense possibly damaging 0.81
R3832:Ttll4 UTSW 1 74686391 missense probably damaging 1.00
R4707:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R4784:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R4785:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R5176:Ttll4 UTSW 1 74679286 missense probably damaging 0.99
R5202:Ttll4 UTSW 1 74687852 critical splice donor site probably null
R5244:Ttll4 UTSW 1 74696448 missense probably benign 0.30
R5264:Ttll4 UTSW 1 74686376 missense possibly damaging 0.92
R5452:Ttll4 UTSW 1 74679321 missense probably benign 0.06
R5992:Ttll4 UTSW 1 74685391 missense probably damaging 1.00
R6722:Ttll4 UTSW 1 74681789 missense possibly damaging 0.95
R6776:Ttll4 UTSW 1 74681353 missense probably damaging 1.00
R6815:Ttll4 UTSW 1 74679349 missense possibly damaging 0.89
R6836:Ttll4 UTSW 1 74689413 missense probably damaging 0.98
R6963:Ttll4 UTSW 1 74681816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGATCATGACAGTAAGAGG -3'
(R):5'- TCCCTTGAGGTAGCTGAGTG -3'

Sequencing Primer
(F):5'- AGTGTCAGAATCTGCAGCC -3'
(R):5'- CTGAGTGCTCCTGTGCAG -3'
Posted On2017-08-16