Incidental Mutation 'R6111:Kcnq1'
ID484843
Institutional Source Beutler Lab
Gene Symbol Kcnq1
Ensembl Gene ENSMUSG00000009545
Gene Namepotassium voltage-gated channel, subfamily Q, member 1
SynonymsKVLQT1, Kcna9
MMRRC Submission 044260-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R6111 (G1)
Quality Score192.009
Status Validated
Chromosome7
Chromosomal Location143106362-143427042 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143107737 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 63 (T63A)
Ref Sequence ENSEMBL: ENSMUSP00000139548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009689] [ENSMUST00000185383] [ENSMUST00000186284] [ENSMUST00000186288] [ENSMUST00000186488] [ENSMUST00000186798] [ENSMUST00000187213]
Predicted Effect probably benign
Transcript: ENSMUST00000009689
AA Change: T127A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000009689
Gene: ENSMUSG00000009545
AA Change: T127A

DomainStartEndE-ValueType
Pfam:Ion_trans 121 358 7.5e-28 PFAM
Pfam:Ion_trans_2 261 351 5.9e-13 PFAM
low complexity region 404 427 N/A INTRINSIC
Pfam:KCNQ_channel 480 624 1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185383
AA Change: T63A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139548
Gene: ENSMUSG00000009545
AA Change: T63A

DomainStartEndE-ValueType
transmembrane domain 58 80 N/A INTRINSIC
Pfam:Ion_trans 93 282 1.4e-23 PFAM
Pfam:Ion_trans_2 198 287 1.2e-11 PFAM
low complexity region 340 363 N/A INTRINSIC
low complexity region 422 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186284
Predicted Effect probably benign
Transcript: ENSMUST00000186288
Predicted Effect probably benign
Transcript: ENSMUST00000186488
SMART Domains Protein: ENSMUSP00000140673
Gene: ENSMUSG00000009545

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186798
Predicted Effect probably benign
Transcript: ENSMUST00000187213
Meta Mutation Damage Score 0.1132 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated potassium channel required for repolarization phase of the cardiac action potential. This protein can form heteromultimers with two other potassium channel proteins, KCNE1 and KCNE3. Mutations in this gene are associated with hereditary long QT syndrome 1 (also known as Romano-Ward syndrome), Jervell and Lange-Nielsen syndrome, and familial atrial fibrillation. This gene exhibits tissue-specific imprinting, with preferential expression from the maternal allele in some tissues, and biallelic expression in others. This gene is located in a region of chromosome 11 amongst other imprinted genes that are associated with Beckwith-Wiedemann syndrome (BWS), and itself has been shown to be disrupted by chromosomal rearrangements in patients with BWS. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous targeted null or spontaneous mutants show circling and head-tossing behavior and are deaf with inner ear dysmorphology. Paternal inheritance of a deletion of an imprinted control region within an intron of this gene results in small body size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik T C 14: 32,806,798 I40T possibly damaging Het
2210408I21Rik A G 13: 77,327,902 E1110G possibly damaging Het
Abcd4 G A 12: 84,615,114 T79I probably damaging Het
Acd A G 8: 105,698,287 M407T probably benign Het
Adcy2 T A 13: 68,729,241 H460L probably damaging Het
Arntl2 T C 6: 146,820,599 F223L probably benign Het
Atad2 G A 15: 58,108,091 H752Y probably benign Het
Camsap2 A G 1: 136,281,298 S819P probably benign Het
Col24a1 C A 3: 145,314,054 T62K probably damaging Het
Cpne6 G A 14: 55,514,634 V283M probably benign Het
D630003M21Rik A G 2: 158,213,448 S590P probably damaging Het
Daam1 T A 12: 71,942,264 M146K unknown Het
Dclk2 A G 3: 86,805,661 Y495H probably benign Het
Ddx4 A T 13: 112,621,232 C330* probably null Het
Dlec1 T C 9: 119,102,624 L37P possibly damaging Het
Dock2 G A 11: 34,708,787 P322S probably damaging Het
Espl1 A G 15: 102,299,888 E443G probably damaging Het
Eya4 T A 10: 23,140,055 D338V possibly damaging Het
Fcmr A G 1: 130,877,829 I267V probably damaging Het
Gfra3 T A 18: 34,690,874 H349L probably damaging Het
Gm25747 A G 12: 113,429,083 probably benign Het
Gria4 G A 9: 4,502,430 R368C probably damaging Het
H2-Q5 A T 17: 35,394,909 I145F possibly damaging Het
Hace1 A T 10: 45,589,510 K54I possibly damaging Het
Ift122 T A 6: 115,875,286 I79N probably damaging Het
Ino80b A G 6: 83,124,366 V121A probably damaging Het
Map4k4 C A 1: 40,011,662 Q762K probably benign Het
Mios G A 6: 8,214,836 A11T probably benign Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Notch2 T C 3: 98,146,293 S2091P probably benign Het
Nudt19 T A 7: 35,555,527 D93V probably benign Het
Olfr875 T C 9: 37,772,932 I91T probably damaging Het
Osbpl2 A G 2: 180,150,201 T233A probably benign Het
P3h1 C T 4: 119,241,132 R369* probably null Het
Pcdhb3 A T 18: 37,302,189 I403L probably benign Het
Pigo T C 4: 43,019,724 D935G probably benign Het
Plpp1 A G 13: 112,866,917 H224R probably damaging Het
Rai1 T A 11: 60,187,906 M932K probably damaging Het
Rexo2 A T 9: 48,473,112 F122L probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Sdc3 A G 4: 130,818,842 T77A unknown Het
Skint5 T C 4: 113,705,648 T786A unknown Het
Smok3c C A 5: 138,065,103 P284Q probably damaging Het
Spg11 A G 2: 122,093,482 V786A probably damaging Het
Tnfrsf10b T A 14: 69,782,558 C380S possibly damaging Het
Tsen54 T C 11: 115,820,130 V176A possibly damaging Het
Ttll4 A T 1: 74,697,539 K1141M possibly damaging Het
Ttpa A T 4: 20,014,772 I116F probably damaging Het
Tubgcp6 T C 15: 89,100,920 D1655G possibly damaging Het
Usp38 A G 8: 81,013,922 V172A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Wdr72 T C 9: 74,210,325 M773T probably benign Het
Xirp2 T A 2: 67,511,817 H1467Q possibly damaging Het
Zdhhc8 G T 16: 18,224,898 S479R probably damaging Het
Zfp423 A G 8: 87,782,687 V322A probably damaging Het
Zfp72 T G 13: 74,372,385 E191D probably benign Het
Zfp933 T C 4: 147,828,760 T14A probably damaging Het
Other mutations in Kcnq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Kcnq1 APN 7 143194278 nonsense probably null
IGL01936:Kcnq1 APN 7 143184504 missense possibly damaging 0.83
IGL02134:Kcnq1 APN 7 143183716 missense possibly damaging 0.66
IGL02613:Kcnq1 APN 7 143426126 unclassified probably benign
R0841:Kcnq1 UTSW 7 143107452 missense probably benign 0.07
R1843:Kcnq1 UTSW 7 143183120 missense probably benign 0.03
R2571:Kcnq1 UTSW 7 143107696 missense probably benign 0.35
R2910:Kcnq1 UTSW 7 143425962 missense probably damaging 1.00
R3943:Kcnq1 UTSW 7 143426088 missense probably damaging 1.00
R4274:Kcnq1 UTSW 7 143184442 missense probably damaging 1.00
R4686:Kcnq1 UTSW 7 143107729 missense probably benign 0.44
R4795:Kcnq1 UTSW 7 143182757 missense probably benign 0.01
R5133:Kcnq1 UTSW 7 143194346 critical splice donor site probably null
R5151:Kcnq1 UTSW 7 143426012 missense probably benign
R5658:Kcnq1 UTSW 7 143363695 critical splice donor site probably null
R5732:Kcnq1 UTSW 7 143148756 intron probably benign
R5990:Kcnq1 UTSW 7 143261368 missense probably damaging 1.00
R6025:Kcnq1 UTSW 7 143106433 unclassified probably benign
R6534:Kcnq1 UTSW 7 143194327 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AGTGTCCCTTCTCACTGGAG -3'
(R):5'- TTGGTGTACTGCAAGTGTCCC -3'

Sequencing Primer
(F):5'- TGAGGGCAGCACGGTCTATG -3'
(R):5'- GCAAGTGTCCCCCTCCAC -3'
Posted On2017-08-16