Incidental Mutation 'R6112:Ift172'
ID484896
Institutional Source Beutler Lab
Gene Symbol Ift172
Ensembl Gene ENSMUSG00000038564
Gene Nameintraflagellar transport 172
Synonymswim
MMRRC Submission 044261-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6112 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location31253277-31291116 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31256897 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1435 (T1435A)
Ref Sequence ENSEMBL: ENSMUSP00000049335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041565] [ENSMUST00000054829] [ENSMUST00000201625] [ENSMUST00000201937]
Predicted Effect probably benign
Transcript: ENSMUST00000041565
AA Change: T1435A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049335
Gene: ENSMUSG00000038564
AA Change: T1435A

DomainStartEndE-ValueType
WD40 2 44 6e-3 SMART
WD40 55 94 2.22e0 SMART
WD40 102 139 1.23e2 SMART
WD40 141 180 4.6e0 SMART
WD40 186 223 3.3e1 SMART
WD40 225 267 4.42e1 SMART
WD40 279 314 1.03e1 SMART
Blast:WD40 516 550 5e-13 BLAST
low complexity region 573 588 N/A INTRINSIC
internal_repeat_1 625 1026 1.7e-10 PROSPERO
Blast:TPR 1029 1062 2e-13 BLAST
low complexity region 1077 1091 N/A INTRINSIC
internal_repeat_1 1101 1498 1.7e-10 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000054829
SMART Domains Protein: ENSMUSP00000060414
Gene: ENSMUSG00000029149

DomainStartEndE-ValueType
Pfam:BCLP 19 211 8.6e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201333
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201565
Predicted Effect probably benign
Transcript: ENSMUST00000201625
SMART Domains Protein: ENSMUSP00000144052
Gene: ENSMUSG00000029149

DomainStartEndE-ValueType
Pfam:BCLP 19 206 1.8e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201697
Predicted Effect probably benign
Transcript: ENSMUST00000201937
SMART Domains Protein: ENSMUSP00000144464
Gene: ENSMUSG00000029149

DomainStartEndE-ValueType
Pfam:BCLP 19 206 1.8e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202560
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the intraflagellar transport subcomplex IFT-B. Subcomplexes IFT-A and IFT-B are necessary for ciliary assembly and maintenance. Mutations in this gene have been associated with skeletal ciliopathies, with or without polydactyly, such as such short-rib thoracic dysplasias 1, 9 or 10. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality during organogenesis, neural tube defects, and developmental patterning abnormalities. Mice homozygous for a conditional allele activated in the early limb bud exhibit polydactyly and short limbs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,460,916 Y1030C probably damaging Het
Adh5 G T 3: 138,451,268 V197F probably damaging Het
Ankmy1 A T 1: 92,870,962 F936I probably damaging Het
Aoc1 A T 6: 48,908,691 D710V probably damaging Het
Aplp1 T C 7: 30,435,477 E622G probably damaging Het
Arhgap20 T C 9: 51,829,384 Y219H probably damaging Het
Bag3 A G 7: 128,541,832 D184G probably damaging Het
Cacna1g C T 11: 94,409,246 A2216T probably damaging Het
Cbarp T C 10: 80,135,371 probably null Het
Cep250 C A 2: 155,994,583 L2211I possibly damaging Het
Cfap65 A G 1: 74,903,139 I1752T probably benign Het
Col4a4 A G 1: 82,453,883 V1560A unknown Het
Dapk3 A T 10: 81,184,030 Q6L probably benign Het
Dctn5 A G 7: 122,133,237 probably benign Het
Eef1akmt1 A T 14: 57,549,873 I182N possibly damaging Het
Eef1g T C 19: 8,977,591 F346S probably damaging Het
Erap1 G T 13: 74,646,279 W19L probably benign Het
Gm10801 A G 2: 98,664,064 H162R probably benign Het
Gpm6a G A 8: 55,054,810 A194T probably benign Het
Grip1 C A 10: 119,993,232 N32K probably benign Het
Hmcn1 A G 1: 150,618,936 I4134T probably damaging Het
Hspa14 G A 2: 3,498,068 H230Y probably benign Het
Igsf3 T A 3: 101,451,006 Y738N probably damaging Het
Lcor T C 19: 41,559,081 V368A possibly damaging Het
Lmna C A 3: 88,486,621 E217* probably null Het
Lrp1b C T 2: 41,341,882 G337E probably benign Het
Maf1 A G 15: 76,352,112 probably benign Het
Magi1 T C 6: 93,745,590 I436V probably damaging Het
Muc4 C T 16: 32,775,783 T3123I possibly damaging Het
Muc5b T A 7: 141,863,305 H3329Q probably benign Het
Noa1 C T 5: 77,309,746 R104Q probably benign Het
Odc1 T G 12: 17,549,472 S267A probably benign Het
Olfr484 T A 7: 108,125,162 I34F probably benign Het
Pam A G 1: 97,834,468 Y691H probably damaging Het
Pamr1 T C 2: 102,611,608 Y181H probably damaging Het
Pcdhga2 T A 18: 37,669,559 I152N probably damaging Het
Pigt C T 2: 164,506,445 Q437* probably null Het
Prx T C 7: 27,516,548 L158P probably damaging Het
Ptprh T A 7: 4,597,923 T152S probably benign Het
Pum1 G A 4: 130,730,280 R201H probably damaging Het
Rad51ap2 T C 12: 11,457,289 I404T probably benign Het
Radil C T 5: 142,543,644 R99H probably damaging Het
Rc3h2 C T 2: 37,378,887 V856I possibly damaging Het
Slx4ip T A 2: 137,046,744 V115E probably damaging Het
Snx3 C A 10: 42,526,046 S85R probably benign Het
Sppl2c A T 11: 104,187,137 E254D probably benign Het
Srms C A 2: 181,207,987 E237* probably null Het
Tenm1 C T X: 42,827,195 G404E probably damaging Het
Trank1 T C 9: 111,391,737 L2514P probably damaging Het
Trib1 C T 15: 59,651,638 R174* probably null Het
Usp4 A G 9: 108,356,504 Y108C probably damaging Het
Vmn2r60 A T 7: 42,195,423 I737F probably damaging Het
Zfp600 A T 4: 146,195,131 H123L probably benign Het
Zfp646 G T 7: 127,879,018 R122S possibly damaging Het
Znfx1 A G 2: 167,038,206 Y553H probably benign Het
Other mutations in Ift172
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Ift172 APN 5 31275896 missense probably damaging 1.00
IGL01399:Ift172 APN 5 31266248 missense probably benign
IGL01405:Ift172 APN 5 31261852 nonsense probably null
IGL01562:Ift172 APN 5 31267247 missense probably damaging 0.97
IGL01758:Ift172 APN 5 31280714 missense probably benign
IGL01792:Ift172 APN 5 31276871 missense probably damaging 1.00
IGL01830:Ift172 APN 5 31285292 missense probably damaging 1.00
IGL01839:Ift172 APN 5 31266350 missense probably damaging 1.00
IGL02007:Ift172 APN 5 31286604 missense probably benign 0.17
IGL02172:Ift172 APN 5 31281337 splice site probably benign
IGL02190:Ift172 APN 5 31254458 missense possibly damaging 0.51
IGL02334:Ift172 APN 5 31283058 missense probably benign 0.00
IGL02486:Ift172 APN 5 31257583 missense probably damaging 1.00
IGL02517:Ift172 APN 5 31253648 unclassified probably null
IGL02571:Ift172 APN 5 31257891 missense probably damaging 1.00
IGL02626:Ift172 APN 5 31264496 missense probably benign
IGL03183:Ift172 APN 5 31272004 missense probably benign 0.06
IGL03277:Ift172 APN 5 31267298 missense possibly damaging 0.92
IGL03349:Ift172 APN 5 31284130 missense probably benign 0.05
pushback UTSW 5 31286945 missense probably damaging 1.00
P0042:Ift172 UTSW 5 31261455 missense probably benign 0.35
PIT4802001:Ift172 UTSW 5 31285266 missense probably benign 0.03
R0153:Ift172 UTSW 5 31260624 missense probably benign
R0328:Ift172 UTSW 5 31263851 nonsense probably null
R0357:Ift172 UTSW 5 31257900 missense possibly damaging 0.51
R0369:Ift172 UTSW 5 31253641 missense probably damaging 1.00
R0391:Ift172 UTSW 5 31286667 missense probably damaging 1.00
R0512:Ift172 UTSW 5 31285477 missense possibly damaging 0.92
R0546:Ift172 UTSW 5 31257601 missense probably benign 0.14
R0553:Ift172 UTSW 5 31275842 splice site probably benign
R0606:Ift172 UTSW 5 31254313 missense probably damaging 0.99
R0834:Ift172 UTSW 5 31257371 missense probably benign
R0973:Ift172 UTSW 5 31257918 unclassified probably benign
R0973:Ift172 UTSW 5 31265355 missense probably benign
R1189:Ift172 UTSW 5 31285830 critical splice acceptor site probably null
R1205:Ift172 UTSW 5 31285792 missense probably benign
R1289:Ift172 UTSW 5 31280976 missense probably damaging 0.98
R1342:Ift172 UTSW 5 31261866 missense probably benign
R1395:Ift172 UTSW 5 31285238 unclassified probably benign
R1417:Ift172 UTSW 5 31256649 missense probably damaging 1.00
R2020:Ift172 UTSW 5 31267241 nonsense probably null
R2111:Ift172 UTSW 5 31286079 missense probably benign 0.04
R2175:Ift172 UTSW 5 31266685 missense probably damaging 1.00
R2509:Ift172 UTSW 5 31262968 missense probably benign
R2870:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2870:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2871:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2871:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2872:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2872:Ift172 UTSW 5 31257861 missense probably benign 0.00
R3705:Ift172 UTSW 5 31261437 critical splice donor site probably null
R3793:Ift172 UTSW 5 31257581 missense possibly damaging 0.61
R4385:Ift172 UTSW 5 31286967 missense probably damaging 1.00
R4477:Ift172 UTSW 5 31265437 missense probably benign 0.38
R4590:Ift172 UTSW 5 31253955 missense probably damaging 1.00
R4663:Ift172 UTSW 5 31284215 missense probably benign 0.01
R4665:Ift172 UTSW 5 31285254 missense possibly damaging 0.82
R4977:Ift172 UTSW 5 31272116 missense possibly damaging 0.79
R5109:Ift172 UTSW 5 31265986 missense probably benign 0.06
R5182:Ift172 UTSW 5 31267614 missense possibly damaging 0.51
R5343:Ift172 UTSW 5 31263812 missense probably benign 0.05
R5465:Ift172 UTSW 5 31261518 splice site probably null
R5622:Ift172 UTSW 5 31283082 missense probably damaging 1.00
R5718:Ift172 UTSW 5 31255277 missense possibly damaging 0.94
R5793:Ift172 UTSW 5 31276948 missense possibly damaging 0.96
R5870:Ift172 UTSW 5 31276940 missense probably benign 0.10
R5919:Ift172 UTSW 5 31260662 missense possibly damaging 0.63
R5968:Ift172 UTSW 5 31261484 missense probably damaging 1.00
R6339:Ift172 UTSW 5 31256583 missense probably benign 0.00
R6339:Ift172 UTSW 5 31286945 missense probably damaging 1.00
R6355:Ift172 UTSW 5 31284157 missense probably benign 0.33
R6565:Ift172 UTSW 5 31275883 missense possibly damaging 0.68
R6668:Ift172 UTSW 5 31255339 missense probably benign 0.00
R6755:Ift172 UTSW 5 31260998 nonsense probably null
R6818:Ift172 UTSW 5 31265960 missense probably benign 0.01
R6939:Ift172 UTSW 5 31257586 missense probably damaging 1.00
R6980:Ift172 UTSW 5 31257386 missense probably benign
R7047:Ift172 UTSW 5 31275894 nonsense probably null
X0022:Ift172 UTSW 5 31285320 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CATGGACAAGGCTCAGATCAATAAG -3'
(R):5'- TATATGGCACTGGGTTCGGC -3'

Sequencing Primer
(F):5'- GCTCAGATCAATAAGAACTGGC -3'
(R):5'- GGCCCCAGCAGCACAAG -3'
Posted On2017-08-16