Incidental Mutation 'R6112:Cacna1g'
ID484918
Institutional Source Beutler Lab
Gene Symbol Cacna1g
Ensembl Gene ENSMUSG00000020866
Gene Namecalcium channel, voltage-dependent, T type, alpha 1G subunit
Synonymsa1G, Cav3.1d
MMRRC Submission 044261-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.381) question?
Stock #R6112 (G1)
Quality Score179.009
Status Validated
Chromosome11
Chromosomal Location94408391-94474198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94409246 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 2216 (A2216T)
Ref Sequence ENSEMBL: ENSMUSP00000103415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021234] [ENSMUST00000100561] [ENSMUST00000103166] [ENSMUST00000107785] [ENSMUST00000107786] [ENSMUST00000107788] [ENSMUST00000107789] [ENSMUST00000107790] [ENSMUST00000107791] [ENSMUST00000107792] [ENSMUST00000107793]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021234
AA Change: A2240T

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021234
Gene: ENSMUSG00000020866
AA Change: A2240T

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 9.2e-66 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 7.9e-46 PFAM
low complexity region 1040 1051 N/A INTRINSIC
low complexity region 1063 1090 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Pfam:Ion_trans 1290 1514 3e-55 PFAM
coiled coil region 1519 1559 N/A INTRINSIC
low complexity region 1562 1573 N/A INTRINSIC
Pfam:Ion_trans 1630 1835 3e-49 PFAM
Pfam:PKD_channel 1688 1842 7.8e-11 PFAM
low complexity region 2180 2211 N/A INTRINSIC
low complexity region 2230 2246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100561
AA Change: A2263T

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000098127
Gene: ENSMUSG00000020866
AA Change: A2263T

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.9e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1086 1113 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1216 1227 N/A INTRINSIC
Pfam:Ion_trans 1313 1537 6.1e-55 PFAM
coiled coil region 1542 1582 N/A INTRINSIC
low complexity region 1585 1596 N/A INTRINSIC
Pfam:Ion_trans 1653 1858 6.2e-49 PFAM
Pfam:PKD_channel 1711 1865 1.4e-10 PFAM
low complexity region 2203 2234 N/A INTRINSIC
low complexity region 2253 2269 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103166
AA Change: A2256T

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099455
Gene: ENSMUSG00000020866
AA Change: A2256T

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.9e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1086 1113 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1216 1227 N/A INTRINSIC
Pfam:Ion_trans 1313 1537 6.1e-55 PFAM
SCOP:d1g2qa_ 1545 1589 6e-3 SMART
Pfam:Ion_trans 1646 1851 6.2e-49 PFAM
Pfam:PKD_channel 1704 1858 1.4e-10 PFAM
low complexity region 2196 2227 N/A INTRINSIC
low complexity region 2246 2262 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107785
AA Change: A2144T

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103414
Gene: ENSMUSG00000020866
AA Change: A2144T

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.8e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.5e-45 PFAM
low complexity region 1040 1051 N/A INTRINSIC
low complexity region 1063 1090 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Pfam:Ion_trans 1290 1514 5.7e-55 PFAM
coiled coil region 1519 1558 N/A INTRINSIC
Pfam:Ion_trans 1612 1817 5.8e-49 PFAM
Pfam:PKD_channel 1670 1824 1.4e-10 PFAM
low complexity region 2027 2042 N/A INTRINSIC
low complexity region 2084 2115 N/A INTRINSIC
low complexity region 2134 2150 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107786
AA Change: A2216T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103415
Gene: ENSMUSG00000020866
AA Change: A2216T

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 383 4e-60 PFAM
low complexity region 466 490 N/A INTRINSIC
low complexity region 518 530 N/A INTRINSIC
Pfam:Ion_trans 760 946 1.6e-45 PFAM
low complexity region 1023 1034 N/A INTRINSIC
low complexity region 1046 1073 N/A INTRINSIC
low complexity region 1094 1110 N/A INTRINSIC
low complexity region 1176 1187 N/A INTRINSIC
Pfam:Ion_trans 1273 1497 5.9e-55 PFAM
SCOP:d1g2qa_ 1505 1549 6e-3 SMART
Pfam:Ion_trans 1606 1811 6e-49 PFAM
Pfam:PKD_channel 1664 1818 1.4e-10 PFAM
low complexity region 2156 2187 N/A INTRINSIC
low complexity region 2206 2222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107788
AA Change: A2238T

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000103417
Gene: ENSMUSG00000020866
AA Change: A2238T

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.9e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1086 1113 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1216 1227 N/A INTRINSIC
Pfam:Ion_trans 1313 1537 6e-55 PFAM
coiled coil region 1542 1574 N/A INTRINSIC
Pfam:Ion_trans 1628 1833 6.1e-49 PFAM
Pfam:PKD_channel 1686 1840 1.4e-10 PFAM
low complexity region 2178 2209 N/A INTRINSIC
low complexity region 2228 2244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107789
AA Change: A2349T

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103418
Gene: ENSMUSG00000020866
AA Change: A2349T

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 80 406 1.6e-76 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 742 972 3.4e-56 PFAM
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1086 1113 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1216 1227 N/A INTRINSIC
Pfam:Ion_trans 1276 1549 1.5e-61 PFAM
low complexity region 1578 1589 N/A INTRINSIC
Pfam:Ion_trans 1611 1863 2.1e-56 PFAM
Pfam:PKD_channel 1703 1858 3.4e-9 PFAM
low complexity region 2289 2320 N/A INTRINSIC
low complexity region 2339 2355 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107790
AA Change: A2233T

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103419
Gene: ENSMUSG00000020866
AA Change: A2233T

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.9e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1040 1051 N/A INTRINSIC
low complexity region 1063 1090 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Pfam:Ion_trans 1290 1514 6e-55 PFAM
SCOP:d1g2qa_ 1522 1566 6e-3 SMART
Pfam:Ion_trans 1623 1828 6.1e-49 PFAM
Pfam:PKD_channel 1681 1835 1.4e-10 PFAM
low complexity region 2173 2204 N/A INTRINSIC
low complexity region 2223 2239 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107791
AA Change: A2222T

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103420
Gene: ENSMUSG00000020866
AA Change: A2222T

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.8e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1040 1051 N/A INTRINSIC
low complexity region 1063 1090 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Pfam:Ion_trans 1290 1514 6e-55 PFAM
coiled coil region 1519 1558 N/A INTRINSIC
Pfam:Ion_trans 1612 1817 6e-49 PFAM
Pfam:PKD_channel 1670 1824 1.4e-10 PFAM
low complexity region 2162 2193 N/A INTRINSIC
low complexity region 2212 2228 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107792
AA Change: A2215T

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103421
Gene: ENSMUSG00000020866
AA Change: A2215T

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.8e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1040 1051 N/A INTRINSIC
low complexity region 1063 1090 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Pfam:Ion_trans 1290 1514 5.9e-55 PFAM
coiled coil region 1519 1551 N/A INTRINSIC
Pfam:Ion_trans 1605 1810 6e-49 PFAM
Pfam:PKD_channel 1663 1817 1.4e-10 PFAM
low complexity region 2155 2186 N/A INTRINSIC
low complexity region 2205 2221 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107793
AA Change: A2245T

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103422
Gene: ENSMUSG00000020866
AA Change: A2245T

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.9e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1086 1113 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1216 1227 N/A INTRINSIC
Pfam:Ion_trans 1313 1537 6e-55 PFAM
coiled coil region 1542 1581 N/A INTRINSIC
Pfam:Ion_trans 1635 1840 6.1e-49 PFAM
Pfam:PKD_channel 1693 1847 1.4e-10 PFAM
low complexity region 2185 2216 N/A INTRINSIC
low complexity region 2235 2251 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146160
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-sensitive calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, gene expression, cell motility, cell division, and cell death. This gene encodes a T-type, low-voltage activated calcium channel. The T-type channels generate currents that are both transient, owing to fast inactivation, and tiny, owing to small conductance. T-type channels are thought to be involved in pacemaker activity, low-threshold calcium spikes, neuronal oscillations and resonance, and rebound burst firing. Many alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygote null mice display disrupted sleeping patterns, altered amounts of activity, abnormal action potentials in the brain, prolonged electrical conductance in the heart, and resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,460,916 Y1030C probably damaging Het
Adh5 G T 3: 138,451,268 V197F probably damaging Het
Ankmy1 A T 1: 92,870,962 F936I probably damaging Het
Aoc1 A T 6: 48,908,691 D710V probably damaging Het
Aplp1 T C 7: 30,435,477 E622G probably damaging Het
Arhgap20 T C 9: 51,829,384 Y219H probably damaging Het
Bag3 A G 7: 128,541,832 D184G probably damaging Het
Cbarp T C 10: 80,135,371 probably null Het
Cep250 C A 2: 155,994,583 L2211I possibly damaging Het
Cfap65 A G 1: 74,903,139 I1752T probably benign Het
Col4a4 A G 1: 82,453,883 V1560A unknown Het
Dapk3 A T 10: 81,184,030 Q6L probably benign Het
Dctn5 A G 7: 122,133,237 probably benign Het
Eef1akmt1 A T 14: 57,549,873 I182N possibly damaging Het
Eef1g T C 19: 8,977,591 F346S probably damaging Het
Erap1 G T 13: 74,646,279 W19L probably benign Het
Gm10801 A G 2: 98,664,064 H162R probably benign Het
Gpm6a G A 8: 55,054,810 A194T probably benign Het
Grip1 C A 10: 119,993,232 N32K probably benign Het
Hmcn1 A G 1: 150,618,936 I4134T probably damaging Het
Hspa14 G A 2: 3,498,068 H230Y probably benign Het
Ift172 T C 5: 31,256,897 T1435A probably benign Het
Igsf3 T A 3: 101,451,006 Y738N probably damaging Het
Lcor T C 19: 41,559,081 V368A possibly damaging Het
Lmna C A 3: 88,486,621 E217* probably null Het
Lrp1b C T 2: 41,341,882 G337E probably benign Het
Maf1 A G 15: 76,352,112 probably benign Het
Magi1 T C 6: 93,745,590 I436V probably damaging Het
Muc4 C T 16: 32,775,783 T3123I possibly damaging Het
Muc5b T A 7: 141,863,305 H3329Q probably benign Het
Noa1 C T 5: 77,309,746 R104Q probably benign Het
Odc1 T G 12: 17,549,472 S267A probably benign Het
Olfr484 T A 7: 108,125,162 I34F probably benign Het
Pam A G 1: 97,834,468 Y691H probably damaging Het
Pamr1 T C 2: 102,611,608 Y181H probably damaging Het
Pcdhga2 T A 18: 37,669,559 I152N probably damaging Het
Pigt C T 2: 164,506,445 Q437* probably null Het
Prx T C 7: 27,516,548 L158P probably damaging Het
Ptprh T A 7: 4,597,923 T152S probably benign Het
Pum1 G A 4: 130,730,280 R201H probably damaging Het
Rad51ap2 T C 12: 11,457,289 I404T probably benign Het
Radil C T 5: 142,543,644 R99H probably damaging Het
Rc3h2 C T 2: 37,378,887 V856I possibly damaging Het
Slx4ip T A 2: 137,046,744 V115E probably damaging Het
Snx3 C A 10: 42,526,046 S85R probably benign Het
Sppl2c A T 11: 104,187,137 E254D probably benign Het
Srms C A 2: 181,207,987 E237* probably null Het
Tenm1 C T X: 42,827,195 G404E probably damaging Het
Trank1 T C 9: 111,391,737 L2514P probably damaging Het
Trib1 C T 15: 59,651,638 R174* probably null Het
Usp4 A G 9: 108,356,504 Y108C probably damaging Het
Vmn2r60 A T 7: 42,195,423 I737F probably damaging Het
Zfp600 A T 4: 146,195,131 H123L probably benign Het
Zfp646 G T 7: 127,879,018 R122S possibly damaging Het
Znfx1 A G 2: 167,038,206 Y553H probably benign Het
Other mutations in Cacna1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Cacna1g APN 11 94433912 missense probably benign 0.16
IGL01382:Cacna1g APN 11 94465858 missense probably damaging 1.00
IGL01694:Cacna1g APN 11 94429112 missense probably damaging 1.00
IGL01866:Cacna1g APN 11 94457111 missense probably damaging 0.99
IGL02341:Cacna1g APN 11 94462152 missense probably damaging 1.00
IGL02506:Cacna1g APN 11 94429129 missense probably damaging 0.99
IGL02706:Cacna1g APN 11 94456992 missense probably damaging 1.00
IGL02879:Cacna1g APN 11 94409605 missense probably benign 0.12
IGL03366:Cacna1g APN 11 94457151 missense probably damaging 1.00
ANU23:Cacna1g UTSW 11 94466228 critical splice acceptor site probably benign
IGL03134:Cacna1g UTSW 11 94459825 missense probably damaging 1.00
R0092:Cacna1g UTSW 11 94457264 missense probably damaging 1.00
R0123:Cacna1g UTSW 11 94409476 missense probably damaging 1.00
R0178:Cacna1g UTSW 11 94463483 missense probably damaging 1.00
R0375:Cacna1g UTSW 11 94411054 missense possibly damaging 0.79
R0389:Cacna1g UTSW 11 94459697 missense probably damaging 1.00
R0433:Cacna1g UTSW 11 94459207 missense probably benign 0.16
R0458:Cacna1g UTSW 11 94409440 missense probably damaging 0.96
R0498:Cacna1g UTSW 11 94459859 missense probably damaging 1.00
R0629:Cacna1g UTSW 11 94409543 missense possibly damaging 0.93
R0800:Cacna1g UTSW 11 94426439 missense probably damaging 1.00
R1341:Cacna1g UTSW 11 94433756 missense probably damaging 0.99
R1457:Cacna1g UTSW 11 94459555 missense possibly damaging 0.76
R1523:Cacna1g UTSW 11 94442729 critical splice donor site probably null
R1532:Cacna1g UTSW 11 94443331 missense probably damaging 1.00
R1540:Cacna1g UTSW 11 94457039 missense probably damaging 1.00
R1652:Cacna1g UTSW 11 94427404 missense probably damaging 1.00
R1688:Cacna1g UTSW 11 94425953 missense possibly damaging 0.70
R1750:Cacna1g UTSW 11 94443292 missense probably damaging 1.00
R1751:Cacna1g UTSW 11 94459802 missense probably benign 0.35
R1767:Cacna1g UTSW 11 94459802 missense probably benign 0.35
R1847:Cacna1g UTSW 11 94466181 missense probably damaging 1.00
R1924:Cacna1g UTSW 11 94444054 missense possibly damaging 0.93
R1973:Cacna1g UTSW 11 94459777 missense possibly damaging 0.86
R2050:Cacna1g UTSW 11 94409474 missense probably damaging 1.00
R2261:Cacna1g UTSW 11 94457135 missense probably benign 0.42
R2273:Cacna1g UTSW 11 94415936 missense probably damaging 0.98
R2274:Cacna1g UTSW 11 94415936 missense probably damaging 0.98
R2275:Cacna1g UTSW 11 94415936 missense probably damaging 0.98
R2376:Cacna1g UTSW 11 94465908 missense probably damaging 0.99
R3686:Cacna1g UTSW 11 94459090 splice site probably null
R3809:Cacna1g UTSW 11 94416096 missense probably damaging 1.00
R3875:Cacna1g UTSW 11 94437923 missense probably damaging 0.98
R4133:Cacna1g UTSW 11 94432544 missense probably damaging 1.00
R4642:Cacna1g UTSW 11 94418094 missense probably damaging 1.00
R4732:Cacna1g UTSW 11 94443215 missense probably damaging 1.00
R4733:Cacna1g UTSW 11 94443215 missense probably damaging 1.00
R4773:Cacna1g UTSW 11 94411472 missense possibly damaging 0.78
R4798:Cacna1g UTSW 11 94433847 missense probably damaging 1.00
R4839:Cacna1g UTSW 11 94459607 missense probably benign 0.16
R4900:Cacna1g UTSW 11 94459351 missense possibly damaging 0.78
R4927:Cacna1g UTSW 11 94429147 missense probably damaging 1.00
R4930:Cacna1g UTSW 11 94444073 missense probably damaging 1.00
R5050:Cacna1g UTSW 11 94459715 missense probably damaging 1.00
R5117:Cacna1g UTSW 11 94432503 missense probably damaging 1.00
R5186:Cacna1g UTSW 11 94442848 missense probably damaging 1.00
R5364:Cacna1g UTSW 11 94416858 missense probably benign 0.29
R5512:Cacna1g UTSW 11 94444142 missense probably damaging 1.00
R5564:Cacna1g UTSW 11 94430486 missense probably damaging 1.00
R5603:Cacna1g UTSW 11 94439752 missense possibly damaging 0.76
R5682:Cacna1g UTSW 11 94459114 missense probably damaging 1.00
R5818:Cacna1g UTSW 11 94418120 missense probably damaging 1.00
R5828:Cacna1g UTSW 11 94457154 missense probably damaging 1.00
R5882:Cacna1g UTSW 11 94459819 missense probably damaging 1.00
R5884:Cacna1g UTSW 11 94437867 missense probably damaging 1.00
R6075:Cacna1g UTSW 11 94416665 missense probably damaging 1.00
R6122:Cacna1g UTSW 11 94430171 missense probably benign 0.11
R6145:Cacna1g UTSW 11 94462261 missense probably damaging 1.00
R6362:Cacna1g UTSW 11 94439707 critical splice donor site probably null
R6415:Cacna1g UTSW 11 94463417 missense probably damaging 1.00
R6468:Cacna1g UTSW 11 94439722 missense probably damaging 1.00
R6648:Cacna1g UTSW 11 94432569 missense probably damaging 1.00
R6746:Cacna1g UTSW 11 94409427 nonsense probably null
R6764:Cacna1g UTSW 11 94413188 missense possibly damaging 0.95
R6782:Cacna1g UTSW 11 94459550 missense probably damaging 1.00
R6888:Cacna1g UTSW 11 94459207 missense probably benign 0.16
R7148:Cacna1g UTSW 11 94465930 missense probably benign 0.32
R7181:Cacna1g UTSW 11 94415865 missense probably benign 0.21
R7183:Cacna1g UTSW 11 94439737 missense probably benign 0.04
R7193:Cacna1g UTSW 11 94409231 missense possibly damaging 0.60
R7237:Cacna1g UTSW 11 94437879 missense probably benign 0.21
R7254:Cacna1g UTSW 11 94432567 nonsense probably null
R7312:Cacna1g UTSW 11 94432557 missense probably damaging 1.00
X0001:Cacna1g UTSW 11 94409645 missense possibly damaging 0.90
X0019:Cacna1g UTSW 11 94459253 missense probably damaging 0.97
X0065:Cacna1g UTSW 11 94462425 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTTCAGAAGGACTGCCCAGG -3'
(R):5'- AGACACTCCATCGCTGTCAG -3'

Sequencing Primer
(F):5'- GTCTGTTGGGTCAGAAGA -3'
(R):5'- ATCGCTGTCAGCTGCCTG -3'
Posted On2017-08-16