Incidental Mutation 'R6113:Eml5'
ID484968
Institutional Source Beutler Lab
Gene Symbol Eml5
Ensembl Gene ENSMUSG00000051166
Gene Nameechinoderm microtubule associated protein like 5
SynonymsC130068M19Rik
MMRRC Submission 044262-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #R6113 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location98786805-98901484 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 98824674 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 1322 (K1322*)
Ref Sequence ENSEMBL: ENSMUSP00000152709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]
Predicted Effect probably null
Transcript: ENSMUST00000065716
AA Change: K1283*
SMART Domains Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: K1283*

DomainStartEndE-ValueType
Pfam:HELP 1 49 3.3e-21 PFAM
WD40 50 91 6.42e-1 SMART
WD40 94 136 1.08e-4 SMART
WD40 139 178 1.27e-1 SMART
WD40 184 224 2.75e1 SMART
WD40 225 263 2.65e-4 SMART
Blast:WD40 265 312 2e-22 BLAST
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.2e2 SMART
WD40 397 436 8.59e-1 SMART
WD40 444 479 6.6e1 SMART
WD40 505 546 2.74e2 SMART
WD40 552 592 4.8e-2 SMART
low complexity region 609 632 N/A INTRINSIC
Pfam:HELP 656 715 1.4e-20 PFAM
WD40 716 757 1.18e-1 SMART
WD40 760 802 2.84e-4 SMART
WD40 805 844 1.91e1 SMART
WD40 853 891 2.64e2 SMART
WD40 892 929 3.45e-3 SMART
WD40 985 1026 4.55e-3 SMART
WD40 1029 1068 6.39e0 SMART
WD40 1071 1111 5.15e-2 SMART
WD40 1180 1221 1.9e2 SMART
WD40 1227 1267 1.38e0 SMART
low complexity region 1280 1297 N/A INTRINSIC
Pfam:HELP 1335 1410 2.4e-16 PFAM
Blast:WD40 1412 1462 8e-28 BLAST
WD40 1465 1507 1.56e-1 SMART
WD40 1510 1549 2.06e0 SMART
WD40 1558 1597 8.22e1 SMART
WD40 1599 1644 4.26e1 SMART
WD40 1690 1730 2.19e-5 SMART
WD40 1774 1813 5.97e-1 SMART
WD40 1884 1925 2.39e0 SMART
WD40 1931 1971 2.88e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000222128
AA Change: K107*
Predicted Effect probably null
Transcript: ENSMUST00000223282
AA Change: K1322*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C A 16: 8,572,900 T7N probably benign Het
Aldh1l2 G T 10: 83,508,134 C359* probably null Het
Bpifb6 G A 2: 153,910,731 E384K probably benign Het
Chtf18 G A 17: 25,722,867 R544C probably damaging Het
Cilp2 T C 8: 69,882,359 D663G probably benign Het
Cplx3 T A 9: 57,602,440 I92F probably damaging Het
Cr1l T C 1: 195,131,411 probably benign Het
Cyp1a1 T A 9: 57,701,891 F323I probably damaging Het
Dclk1 T C 3: 55,489,819 Y186H probably benign Het
Dclre1c T C 2: 3,452,863 L261P probably damaging Het
Dcst2 T C 3: 89,367,885 S312P possibly damaging Het
Diexf T C 1: 193,129,502 I46V probably null Het
Dnah17 A G 11: 118,126,275 L213P probably damaging Het
Dnd1 T A 18: 36,765,395 Y102F probably damaging Het
Dnm1l T C 16: 16,341,003 N121S probably benign Het
Dsp T A 13: 38,192,047 N1269K probably damaging Het
Dync1h1 T C 12: 110,620,414 V943A probably benign Het
Fam173b T C 15: 31,608,162 Y120H probably damaging Het
Fgf23 A G 6: 127,078,154 T76A probably benign Het
Fgf6 T C 6: 127,015,937 probably null Het
Fkbp15 G A 4: 62,340,647 T124I probably benign Het
Gm12185 A T 11: 48,915,340 H341Q possibly damaging Het
Gm20647 A G 5: 72,329,800 probably benign Het
Lrp2 G C 2: 69,483,557 R2277G possibly damaging Het
Lrrc69 T C 4: 14,708,673 T224A probably benign Het
Ly75 T G 2: 60,368,873 I175L probably benign Het
Morc2b G T 17: 33,138,068 Y243* probably null Het
Myo18b C G 5: 112,866,385 D764H probably damaging Het
Naip6 T C 13: 100,299,286 S910G possibly damaging Het
Nbeal1 T A 1: 60,222,263 I21N possibly damaging Het
P3h2 A T 16: 25,981,153 I430K probably benign Het
Pcdh9 A G 14: 93,887,108 V542A probably damaging Het
Pkp3 T A 7: 141,082,656 N60K probably damaging Het
Pold1 C A 7: 44,537,700 G686C probably damaging Het
Prdm6 T A 18: 53,473,601 L58Q probably damaging Het
Rab13 C A 3: 90,224,866 R86S probably benign Het
Rad21l A C 2: 151,657,478 L265V probably damaging Het
Rec8 G A 14: 55,622,478 A228T probably damaging Het
Rgs12 C A 5: 35,020,323 R76S probably damaging Het
Sfmbt1 A G 14: 30,815,184 N670D possibly damaging Het
Slc17a7 A G 7: 45,174,751 T464A possibly damaging Het
Srcap C A 7: 127,560,281 probably benign Het
Srgap2 A T 1: 131,355,505 probably null Het
Tenm1 C T X: 42,827,195 G404E probably damaging Het
Thpo C A 16: 20,728,847 probably benign Het
Tle4 A T 19: 14,595,588 probably null Het
Tnfrsf14 T C 4: 154,924,492 Q74R possibly damaging Het
Trav15-2-dv6-2 T G 14: 53,649,725 V34G probably benign Het
Trbv13-1 C T 6: 41,116,379 A82V probably benign Het
Trib1 C T 15: 59,651,638 R174* probably null Het
Trpv3 G A 11: 73,286,018 V408I probably benign Het
Tyk2 A T 9: 21,107,922 V1068E probably damaging Het
Usp35 A G 7: 97,324,326 S230P probably damaging Het
Vav1 T A 17: 57,301,884 D349E probably benign Het
Vcan T A 13: 89,657,536 R114* probably null Het
Vmn1r25 T C 6: 57,978,572 E244G probably benign Het
Vmn2r5 T C 3: 64,491,399 T720A probably benign Het
Wdr72 T A 9: 74,152,641 D444E probably benign Het
Zfhx3 T A 8: 108,947,421 M1701K probably benign Het
Other mutations in Eml5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Eml5 APN 12 98873209 splice site probably benign
IGL00473:Eml5 APN 12 98805492 splice site probably benign
IGL01120:Eml5 APN 12 98844019 missense probably benign
IGL01308:Eml5 APN 12 98802313 missense probably damaging 1.00
IGL01790:Eml5 APN 12 98798932 missense probably damaging 1.00
IGL01973:Eml5 APN 12 98863280 missense probably benign
IGL02182:Eml5 APN 12 98802322 missense probably damaging 1.00
IGL02201:Eml5 APN 12 98794424 splice site probably benign
IGL02375:Eml5 APN 12 98844087 missense probably damaging 1.00
IGL02397:Eml5 APN 12 98790674 missense probably benign 0.07
IGL02480:Eml5 APN 12 98876243 missense probably damaging 1.00
IGL02801:Eml5 APN 12 98817845 missense possibly damaging 0.88
IGL02876:Eml5 APN 12 98858841 missense probably damaging 1.00
IGL03104:Eml5 APN 12 98861245 nonsense probably null
IGL03158:Eml5 APN 12 98827514 splice site probably benign
IGL03286:Eml5 APN 12 98860503 missense probably damaging 1.00
IGL03380:Eml5 APN 12 98874647 splice site probably benign
R0573:Eml5 UTSW 12 98824772 splice site probably null
R0624:Eml5 UTSW 12 98865479 missense probably damaging 1.00
R0993:Eml5 UTSW 12 98861183 missense probably benign 0.25
R1073:Eml5 UTSW 12 98830973 missense probably damaging 1.00
R1183:Eml5 UTSW 12 98792046 missense probably benign 0.31
R1352:Eml5 UTSW 12 98831003 splice site probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1503:Eml5 UTSW 12 98831174 missense probably damaging 0.99
R1538:Eml5 UTSW 12 98794276 missense probably damaging 0.99
R1689:Eml5 UTSW 12 98830935 missense probably damaging 1.00
R1773:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1775:Eml5 UTSW 12 98852704 splice site probably null
R1791:Eml5 UTSW 12 98887056 missense probably benign 0.31
R1856:Eml5 UTSW 12 98810584 missense probably damaging 1.00
R1919:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1957:Eml5 UTSW 12 98859961 missense probably damaging 1.00
R1962:Eml5 UTSW 12 98876311 missense probably damaging 0.99
R2033:Eml5 UTSW 12 98791386 missense possibly damaging 0.71
R2035:Eml5 UTSW 12 98794266 missense probably benign 0.33
R2073:Eml5 UTSW 12 98802446 missense probably damaging 0.99
R2143:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2144:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2158:Eml5 UTSW 12 98843946 splice site probably benign
R2164:Eml5 UTSW 12 98887097 missense probably damaging 0.99
R2175:Eml5 UTSW 12 98876223 nonsense probably null
R2200:Eml5 UTSW 12 98825417 missense probably damaging 1.00
R2234:Eml5 UTSW 12 98841581 missense probably damaging 1.00
R2504:Eml5 UTSW 12 98844105 missense possibly damaging 0.71
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2958:Eml5 UTSW 12 98876178 missense possibly damaging 0.74
R3013:Eml5 UTSW 12 98880808 splice site probably null
R3118:Eml5 UTSW 12 98865494 missense probably damaging 0.97
R3735:Eml5 UTSW 12 98855989 missense possibly damaging 0.78
R3856:Eml5 UTSW 12 98816024 missense probably damaging 1.00
R3900:Eml5 UTSW 12 98825523 missense probably damaging 1.00
R3973:Eml5 UTSW 12 98802465 splice site probably benign
R3976:Eml5 UTSW 12 98802465 splice site probably benign
R4105:Eml5 UTSW 12 98841548 splice site probably null
R4107:Eml5 UTSW 12 98841548 splice site probably null
R4108:Eml5 UTSW 12 98841548 splice site probably null
R4109:Eml5 UTSW 12 98841548 splice site probably null
R4258:Eml5 UTSW 12 98865434 missense probably benign 0.01
R4381:Eml5 UTSW 12 98815955 missense possibly damaging 0.93
R4590:Eml5 UTSW 12 98837341 missense possibly damaging 0.91
R4737:Eml5 UTSW 12 98798852 missense probably damaging 1.00
R4775:Eml5 UTSW 12 98802307 missense probably benign 0.05
R4850:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5007:Eml5 UTSW 12 98830965 missense probably damaging 1.00
R5092:Eml5 UTSW 12 98792616 missense probably damaging 1.00
R5123:Eml5 UTSW 12 98874512 missense probably damaging 1.00
R5124:Eml5 UTSW 12 98792042 missense probably damaging 1.00
R5273:Eml5 UTSW 12 98790688 missense probably damaging 1.00
R5369:Eml5 UTSW 12 98858783 missense probably damaging 1.00
R5430:Eml5 UTSW 12 98794158 missense probably damaging 1.00
R5748:Eml5 UTSW 12 98825555 missense probably damaging 0.99
R5769:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5832:Eml5 UTSW 12 98876188 missense probably benign
R6131:Eml5 UTSW 12 98861251 missense probably damaging 0.99
R6175:Eml5 UTSW 12 98794456 missense possibly damaging 0.69
R6184:Eml5 UTSW 12 98863129 missense possibly damaging 0.53
R6357:Eml5 UTSW 12 98870884 missense probably damaging 0.98
R6375:Eml5 UTSW 12 98798868
R6528:Eml5 UTSW 12 98824637 missense probably benign 0.18
R6657:Eml5 UTSW 12 98791405 missense probably damaging 0.98
R6717:Eml5 UTSW 12 98827506 missense probably damaging 1.00
R6751:Eml5 UTSW 12 98865400 missense probably damaging 1.00
R6833:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6834:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6972:Eml5 UTSW 12 98876180 missense probably benign 0.00
R7091:Eml5 UTSW 12 98802474 missense probably benign 0.16
T0722:Eml5 UTSW 12 98841582 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TTCTAACAGTGGCTCACAACTG -3'
(R):5'- TCACACTTAACAGTTGAGGGTAC -3'

Sequencing Primer
(F):5'- GTGGCTCACAACTGCATAAATC -3'
(R):5'- CACATTTTTGTAGCTTGCAGTAATG -3'
Posted On2017-08-16