Incidental Mutation 'R0520:Asxl3'
ID48497
Institutional Source Beutler Lab
Gene Symbol Asxl3
Ensembl Gene ENSMUSG00000045215
Gene Nameadditional sex combs like 3, transcriptional regulator
SynonymsD930044O18Rik, LOC381127, C230079D11Rik, D430002O22Rik
MMRRC Submission 038713-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.546) question?
Stock #R0520 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location22344883-22530227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22522986 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1351 (D1351V)
Ref Sequence ENSEMBL: ENSMUSP00000112793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097655] [ENSMUST00000120223]
Predicted Effect probably damaging
Transcript: ENSMUST00000097655
AA Change: D1351V

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095260
Gene: ENSMUSG00000045215
AA Change: D1351V

DomainStartEndE-ValueType
low complexity region 98 112 N/A INTRINSIC
Pfam:ASXH 173 305 5.6e-50 PFAM
low complexity region 391 404 N/A INTRINSIC
low complexity region 667 686 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
low complexity region 978 988 N/A INTRINSIC
low complexity region 1002 1023 N/A INTRINSIC
low complexity region 1160 1168 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1681 1691 N/A INTRINSIC
SCOP:d1dnpa2 1946 1995 6e-3 SMART
low complexity region 2035 2050 N/A INTRINSIC
Pfam:PHD_3 2139 2202 9.8e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120223
AA Change: D1351V

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112793
Gene: ENSMUSG00000045215
AA Change: D1351V

DomainStartEndE-ValueType
low complexity region 98 112 N/A INTRINSIC
Pfam:ASXH 179 304 1.3e-36 PFAM
low complexity region 391 404 N/A INTRINSIC
low complexity region 667 686 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
low complexity region 978 988 N/A INTRINSIC
low complexity region 1002 1023 N/A INTRINSIC
low complexity region 1160 1168 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1681 1691 N/A INTRINSIC
SCOP:d1dnpa2 1946 1995 6e-3 SMART
low complexity region 2035 2050 N/A INTRINSIC
Pfam:PHD_3 2138 2202 1.9e-24 PFAM
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010005H15Rik A G 16: 36,253,091 I16V probably benign Het
Acod1 T C 14: 103,051,516 I154T possibly damaging Het
Acr G T 15: 89,573,227 C226F probably damaging Het
Aff1 C T 5: 103,847,751 R1070* probably null Het
Aldh9a1 C T 1: 167,361,391 probably benign Het
Apaf1 A T 10: 91,079,989 H12Q probably damaging Het
Asic1 A T 15: 99,695,535 I291F probably damaging Het
Aspm T A 1: 139,478,820 M1815K possibly damaging Het
Atg9a C T 1: 75,186,534 W299* probably null Het
B3gntl1 C A 11: 121,623,488 V313F possibly damaging Het
B4galnt4 T A 7: 141,067,373 C345* probably null Het
Bicc1 A T 10: 70,957,190 F211L probably damaging Het
Cachd1 T G 4: 100,897,703 V117G probably damaging Het
Cdc16 G A 8: 13,760,569 probably null Het
Cers6 C T 2: 69,105,091 Q312* probably null Het
Dclre1c A G 2: 3,436,475 H115R probably damaging Het
Ddx20 T C 3: 105,687,376 T18A probably benign Het
Dhx57 A G 17: 80,258,175 V816A possibly damaging Het
Dlgap1 C T 17: 70,516,994 Q325* probably null Het
Dnaja1 A T 4: 40,728,072 M178L probably benign Het
Ecd A T 14: 20,328,664 S454T probably benign Het
Efcab6 G A 15: 83,950,046 H454Y probably benign Het
Exo1 T A 1: 175,899,465 D447E probably benign Het
F5 T G 1: 164,209,587 I1965S probably benign Het
Fbn2 A G 18: 58,013,749 C2692R probably damaging Het
Fggy T A 4: 95,601,103 L152Q probably damaging Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Gm9871 A G 6: 101,801,579 noncoding transcript Het
Gnai2 A T 9: 107,620,173 D7E probably benign Het
Gon7 C T 12: 102,757,788 probably benign Het
H2-K1 A T 17: 33,997,416 V272E probably damaging Het
Hectd4 G T 5: 121,331,707 R2555L possibly damaging Het
Hexb T C 13: 97,181,110 R360G probably benign Het
Igsf9b C A 9: 27,323,250 S470R probably benign Het
Inpp5d T C 1: 87,705,920 probably benign Het
Inpp5k C A 11: 75,639,530 Y265* probably null Het
Klhl33 T G 14: 50,891,683 E436D probably damaging Het
Krt80 A G 15: 101,370,017 L13P probably benign Het
Krtap19-2 C T 16: 88,873,861 probably benign Het
March10 T C 11: 105,389,882 T526A probably benign Het
Mcrs1 A G 15: 99,248,455 probably null Het
Msh2 G T 17: 87,717,544 V617F possibly damaging Het
Nckap1 A C 2: 80,541,530 probably benign Het
Nek4 T A 14: 30,959,306 probably benign Het
Olfr1054 G T 2: 86,333,131 T75K probably damaging Het
Olfr1410 T A 1: 92,608,749 V304E probably damaging Het
Olfr871 G A 9: 20,212,495 V49I probably benign Het
Olfr875 T C 9: 37,773,553 V298A probably benign Het
Osgin1 A G 8: 119,442,508 H48R probably damaging Het
Pam T A 1: 97,884,195 T369S probably benign Het
Pclo C T 5: 14,713,830 Q821* probably null Het
Plekhm1 T C 11: 103,394,944 I222V probably benign Het
Ptprg T G 14: 12,199,783 N65K possibly damaging Het
Pum2 T A 12: 8,721,710 V351E probably damaging Het
Slc25a54 T A 3: 109,107,230 probably benign Het
Smchd1 A T 17: 71,429,543 D587E possibly damaging Het
Stap1 A G 5: 86,090,964 M164V probably benign Het
Stat5a T C 11: 100,861,426 V30A probably damaging Het
Stk36 T G 1: 74,602,206 probably benign Het
Tiam1 G T 16: 89,817,951 probably benign Het
Tmc5 T C 7: 118,666,576 M553T probably damaging Het
Tmem14a T A 1: 21,229,412 Y89N possibly damaging Het
Tpp2 A G 1: 43,990,530 Y991C probably damaging Het
Ttc7 A G 17: 87,359,151 K615E possibly damaging Het
Ubac2 C T 14: 121,994,342 P227S probably damaging Het
Vit A C 17: 78,625,159 K565T probably damaging Het
Vps13c T C 9: 67,945,851 F2409L possibly damaging Het
Wdr64 A G 1: 175,726,392 T173A probably damaging Het
Zfp759 T C 13: 67,137,355 I60T probably benign Het
Zfp81 A G 17: 33,334,377 S488P probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Asxl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Asxl3 APN 18 22525223 missense probably benign 0.41
IGL00510:Asxl3 APN 18 22523565 missense probably damaging 1.00
IGL00864:Asxl3 APN 18 22522446 missense probably benign 0.06
IGL01074:Asxl3 APN 18 22522845 missense probably damaging 1.00
IGL01305:Asxl3 APN 18 22516446 missense probably benign 0.06
IGL01313:Asxl3 APN 18 22517459 missense probably benign 0.41
IGL01349:Asxl3 APN 18 22524237 missense probably benign 0.28
IGL01529:Asxl3 APN 18 22517655 missense probably damaging 1.00
IGL01574:Asxl3 APN 18 22523564 missense probably benign 0.06
IGL01583:Asxl3 APN 18 22516597 missense probably benign 0.01
IGL01619:Asxl3 APN 18 22523328 missense probably damaging 1.00
IGL01720:Asxl3 APN 18 22525325 missense probably damaging 1.00
IGL01816:Asxl3 APN 18 22522488 missense probably benign 0.10
IGL01828:Asxl3 APN 18 22525558 utr 3 prime probably benign
IGL01903:Asxl3 APN 18 22434576 missense probably benign 0.00
IGL01906:Asxl3 APN 18 22522281 missense probably benign 0.01
IGL01962:Asxl3 APN 18 22522445 missense probably benign 0.00
IGL01991:Asxl3 APN 18 22516162 missense probably damaging 1.00
IGL02064:Asxl3 APN 18 22524344 missense possibly damaging 0.59
IGL02187:Asxl3 APN 18 22524978 missense probably damaging 0.99
IGL02219:Asxl3 APN 18 22453626 missense possibly damaging 0.81
IGL02309:Asxl3 APN 18 22522453 missense probably benign 0.01
IGL02478:Asxl3 APN 18 22523013 missense possibly damaging 0.77
IGL02506:Asxl3 APN 18 22452399 missense probably benign 0.19
IGL02660:Asxl3 APN 18 22524345 missense probably damaging 0.98
IGL02828:Asxl3 APN 18 22524661 missense possibly damaging 0.87
IGL02863:Asxl3 APN 18 22523484 missense probably benign 0.01
IGL03001:Asxl3 APN 18 22517398 missense probably damaging 1.00
IGL03143:Asxl3 APN 18 22522974 missense probably benign 0.43
ANU22:Asxl3 UTSW 18 22516446 missense probably benign 0.06
R0145:Asxl3 UTSW 18 22453605 missense probably damaging 1.00
R0201:Asxl3 UTSW 18 22523154 missense probably benign
R0207:Asxl3 UTSW 18 22411496 splice site probably benign
R0230:Asxl3 UTSW 18 22452326 splice site probably benign
R0242:Asxl3 UTSW 18 22516681 missense possibly damaging 0.94
R0242:Asxl3 UTSW 18 22516681 missense possibly damaging 0.94
R0344:Asxl3 UTSW 18 22517611 missense probably benign 0.00
R0519:Asxl3 UTSW 18 22523520 missense possibly damaging 0.85
R0548:Asxl3 UTSW 18 22521792 splice site probably benign
R0626:Asxl3 UTSW 18 22522880 missense probably benign 0.02
R0711:Asxl3 UTSW 18 22524451 missense probably benign 0.01
R0744:Asxl3 UTSW 18 22516040 missense probably damaging 1.00
R0833:Asxl3 UTSW 18 22516040 missense probably damaging 1.00
R1035:Asxl3 UTSW 18 22525049 missense probably damaging 1.00
R1170:Asxl3 UTSW 18 22524507 missense probably benign 0.00
R1372:Asxl3 UTSW 18 22410009 missense probably benign 0.00
R1440:Asxl3 UTSW 18 22525224 missense probably benign 0.13
R1463:Asxl3 UTSW 18 22516753 missense possibly damaging 0.94
R1471:Asxl3 UTSW 18 22516354 missense probably damaging 1.00
R1618:Asxl3 UTSW 18 22516987 missense probably damaging 1.00
R1720:Asxl3 UTSW 18 22452435 missense probably damaging 1.00
R1819:Asxl3 UTSW 18 22522376 missense probably damaging 1.00
R1824:Asxl3 UTSW 18 22522068 missense probably damaging 1.00
R1851:Asxl3 UTSW 18 22517739 missense probably damaging 0.97
R1989:Asxl3 UTSW 18 22452363 missense probably damaging 1.00
R2041:Asxl3 UTSW 18 22523451 missense probably benign 0.02
R2174:Asxl3 UTSW 18 22453644 missense possibly damaging 0.76
R2175:Asxl3 UTSW 18 22516595 missense probably benign
R2443:Asxl3 UTSW 18 22411539 missense probably benign 0.12
R2907:Asxl3 UTSW 18 22517273 missense possibly damaging 0.56
R4246:Asxl3 UTSW 18 22525500 missense probably damaging 1.00
R4254:Asxl3 UTSW 18 22524366 missense possibly damaging 0.58
R4441:Asxl3 UTSW 18 22524233 missense probably damaging 0.97
R4660:Asxl3 UTSW 18 22516477 missense probably benign 0.00
R4661:Asxl3 UTSW 18 22516477 missense probably benign 0.00
R4674:Asxl3 UTSW 18 22517738 missense probably damaging 1.00
R4749:Asxl3 UTSW 18 22516769 missense probably damaging 0.99
R4817:Asxl3 UTSW 18 22525454 missense probably damaging 0.97
R4935:Asxl3 UTSW 18 22523312 missense probably benign 0.06
R5062:Asxl3 UTSW 18 22522718 missense possibly damaging 0.92
R5064:Asxl3 UTSW 18 22516019 missense probably benign 0.00
R5065:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5066:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5067:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5133:Asxl3 UTSW 18 22516708 missense probably damaging 1.00
R5174:Asxl3 UTSW 18 22523115 missense probably benign 0.45
R5183:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5294:Asxl3 UTSW 18 22516439 missense possibly damaging 0.77
R5416:Asxl3 UTSW 18 22524494 missense probably damaging 1.00
R5587:Asxl3 UTSW 18 22525247 missense probably benign 0.28
R5873:Asxl3 UTSW 18 22516085 missense probably benign 0.04
R6240:Asxl3 UTSW 18 22465508 missense probably damaging 1.00
R6242:Asxl3 UTSW 18 22522376 missense probably damaging 1.00
R6316:Asxl3 UTSW 18 22522782 missense probably damaging 1.00
R6348:Asxl3 UTSW 18 22517273 missense possibly damaging 0.56
R6518:Asxl3 UTSW 18 22516340 missense probably damaging 0.96
R6605:Asxl3 UTSW 18 22517077 nonsense probably null
R6704:Asxl3 UTSW 18 22517305 missense probably benign 0.00
R6706:Asxl3 UTSW 18 22453609 missense probably damaging 1.00
R6786:Asxl3 UTSW 18 22525440 missense probably damaging 1.00
R6799:Asxl3 UTSW 18 22465400 nonsense probably null
R6811:Asxl3 UTSW 18 22522911 missense possibly damaging 0.87
R6817:Asxl3 UTSW 18 22523580 missense probably benign 0.00
R6830:Asxl3 UTSW 18 22525388 missense probably benign 0.45
R6957:Asxl3 UTSW 18 22522091 missense probably damaging 1.00
R7015:Asxl3 UTSW 18 22523921 missense probably benign 0.00
R7058:Asxl3 UTSW 18 22517674 missense probably damaging 1.00
R7135:Asxl3 UTSW 18 22517701 nonsense probably null
R7135:Asxl3 UTSW 18 22517702 missense probably damaging 1.00
R7231:Asxl3 UTSW 18 22411499 critical splice acceptor site probably null
R7231:Asxl3 UTSW 18 22517540 missense probably damaging 1.00
Z1088:Asxl3 UTSW 18 22516772 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATCAGTACACTTCTGTGCCAGCTC -3'
(R):5'- ACCGACCTAGTCTGGGAATCCAAAC -3'

Sequencing Primer
(F):5'- CCACCATTGCAAGTAATTTGCC -3'
(R):5'- TCCACTTTCAATGGAGACAGTCAG -3'
Posted On2013-06-12