Incidental Mutation 'R6113:Rec8'
ID484975
Institutional Source Beutler Lab
Gene Symbol Rec8
Ensembl Gene ENSMUSG00000002324
Gene NameREC8 meiotic recombination protein
Synonymsmrec, Rec8L1
MMRRC Submission 044262-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6113 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location55618037-55625395 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55622478 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 228 (A228T)
Ref Sequence ENSEMBL: ENSMUSP00000002395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002395] [ENSMUST00000047131] [ENSMUST00000135221] [ENSMUST00000141499] [ENSMUST00000148351]
Predicted Effect probably damaging
Transcript: ENSMUST00000002395
AA Change: A228T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002395
Gene: ENSMUSG00000002324
AA Change: A228T

DomainStartEndE-ValueType
Pfam:Rad21_Rec8_N 1 117 2.2e-26 PFAM
low complexity region 235 249 N/A INTRINSIC
low complexity region 329 347 N/A INTRINSIC
coiled coil region 423 458 N/A INTRINSIC
low complexity region 497 521 N/A INTRINSIC
Pfam:Rad21_Rec8 536 590 9.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047131
SMART Domains Protein: ENSMUSP00000036555
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 4e-20 BLAST
Blast:IBN_N 224 293 4e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.7e-7 PFAM
Blast:ARM 465 499 8e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
low complexity region 811 830 N/A INTRINSIC
low complexity region 851 864 N/A INTRINSIC
Pfam:HEAT 901 931 1.9e-5 PFAM
Pfam:HEAT_EZ 914 969 2.3e-9 PFAM
low complexity region 1043 1053 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126064
Predicted Effect probably benign
Transcript: ENSMUST00000135221
SMART Domains Protein: ENSMUSP00000123692
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 3e-20 BLAST
Blast:IBN_N 224 293 2e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.4e-7 PFAM
Blast:ARM 465 499 7e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141425
Predicted Effect probably benign
Transcript: ENSMUST00000141499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146528
Predicted Effect probably benign
Transcript: ENSMUST00000148351
SMART Domains Protein: ENSMUSP00000117543
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227922
Meta Mutation Damage Score 0.344 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kleisin family of SMC (structural maintenance of chromosome) protein partners. The protein localizes to the axial elements of chromosomes during meiosis in both oocytes and spermatocytes. In the mouse, the homologous protein is a key component of the meiotic cohesion complex, which regulates sister chromatid cohesion and recombination between homologous chromosomes. Multiple alternatively spliced variants, encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are infertile and exhibit small ovaries and testes. Females show absence of ovarian follicles and abnormal meiosis, while males exhibit abnormal chromosome pairing during meiosis, abnormal synaptonemal complex formation, and arrest of male meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C A 16: 8,572,900 T7N probably benign Het
Aldh1l2 G T 10: 83,508,134 C359* probably null Het
Bpifb6 G A 2: 153,910,731 E384K probably benign Het
Chtf18 G A 17: 25,722,867 R544C probably damaging Het
Cilp2 T C 8: 69,882,359 D663G probably benign Het
Cplx3 T A 9: 57,602,440 I92F probably damaging Het
Cr1l T C 1: 195,131,411 probably benign Het
Cyp1a1 T A 9: 57,701,891 F323I probably damaging Het
Dclk1 T C 3: 55,489,819 Y186H probably benign Het
Dclre1c T C 2: 3,452,863 L261P probably damaging Het
Dcst2 T C 3: 89,367,885 S312P possibly damaging Het
Diexf T C 1: 193,129,502 I46V probably null Het
Dnah17 A G 11: 118,126,275 L213P probably damaging Het
Dnd1 T A 18: 36,765,395 Y102F probably damaging Het
Dnm1l T C 16: 16,341,003 N121S probably benign Het
Dsp T A 13: 38,192,047 N1269K probably damaging Het
Dync1h1 T C 12: 110,620,414 V943A probably benign Het
Eml5 T A 12: 98,824,674 K1322* probably null Het
Fam173b T C 15: 31,608,162 Y120H probably damaging Het
Fgf23 A G 6: 127,078,154 T76A probably benign Het
Fgf6 T C 6: 127,015,937 probably null Het
Fkbp15 G A 4: 62,340,647 T124I probably benign Het
Gm12185 A T 11: 48,915,340 H341Q possibly damaging Het
Gm20647 A G 5: 72,329,800 probably benign Het
Lrp2 G C 2: 69,483,557 R2277G possibly damaging Het
Lrrc69 T C 4: 14,708,673 T224A probably benign Het
Ly75 T G 2: 60,368,873 I175L probably benign Het
Morc2b G T 17: 33,138,068 Y243* probably null Het
Myo18b C G 5: 112,866,385 D764H probably damaging Het
Naip6 T C 13: 100,299,286 S910G possibly damaging Het
Nbeal1 T A 1: 60,222,263 I21N possibly damaging Het
P3h2 A T 16: 25,981,153 I430K probably benign Het
Pcdh9 A G 14: 93,887,108 V542A probably damaging Het
Pkp3 T A 7: 141,082,656 N60K probably damaging Het
Pold1 C A 7: 44,537,700 G686C probably damaging Het
Prdm6 T A 18: 53,473,601 L58Q probably damaging Het
Rab13 C A 3: 90,224,866 R86S probably benign Het
Rad21l A C 2: 151,657,478 L265V probably damaging Het
Rgs12 C A 5: 35,020,323 R76S probably damaging Het
Sfmbt1 A G 14: 30,815,184 N670D possibly damaging Het
Slc17a7 A G 7: 45,174,751 T464A possibly damaging Het
Srcap C A 7: 127,560,281 probably benign Het
Srgap2 A T 1: 131,355,505 probably null Het
Tenm1 C T X: 42,827,195 G404E probably damaging Het
Thpo C A 16: 20,728,847 probably benign Het
Tle4 A T 19: 14,595,588 probably null Het
Tnfrsf14 T C 4: 154,924,492 Q74R possibly damaging Het
Trav15-2-dv6-2 T G 14: 53,649,725 V34G probably benign Het
Trbv13-1 C T 6: 41,116,379 A82V probably benign Het
Trib1 C T 15: 59,651,638 R174* probably null Het
Trpv3 G A 11: 73,286,018 V408I probably benign Het
Tyk2 A T 9: 21,107,922 V1068E probably damaging Het
Usp35 A G 7: 97,324,326 S230P probably damaging Het
Vav1 T A 17: 57,301,884 D349E probably benign Het
Vcan T A 13: 89,657,536 R114* probably null Het
Vmn1r25 T C 6: 57,978,572 E244G probably benign Het
Vmn2r5 T C 3: 64,491,399 T720A probably benign Het
Wdr72 T A 9: 74,152,641 D444E probably benign Het
Zfhx3 T A 8: 108,947,421 M1701K probably benign Het
Other mutations in Rec8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Rec8 APN 14 55623515 nonsense probably null
IGL00427:Rec8 APN 14 55618651 missense probably damaging 1.00
IGL02116:Rec8 APN 14 55624879 unclassified probably null
R1349:Rec8 UTSW 14 55618974 missense probably damaging 1.00
R1372:Rec8 UTSW 14 55618974 missense probably damaging 1.00
R1564:Rec8 UTSW 14 55622275 unclassified probably null
R1667:Rec8 UTSW 14 55618796 missense probably damaging 1.00
R1970:Rec8 UTSW 14 55624142 missense probably damaging 1.00
R3157:Rec8 UTSW 14 55625306 missense probably damaging 0.96
R3625:Rec8 UTSW 14 55622497 missense possibly damaging 0.94
R3919:Rec8 UTSW 14 55621259 missense probably benign 0.02
R4280:Rec8 UTSW 14 55618634 missense probably damaging 1.00
R4282:Rec8 UTSW 14 55618634 missense probably damaging 1.00
R4283:Rec8 UTSW 14 55618634 missense probably damaging 1.00
R4622:Rec8 UTSW 14 55624758 missense probably damaging 1.00
R4894:Rec8 UTSW 14 55625330 missense probably damaging 1.00
R5488:Rec8 UTSW 14 55622826 missense probably benign 0.00
R5489:Rec8 UTSW 14 55622826 missense probably benign 0.00
R6264:Rec8 UTSW 14 55619179 missense probably damaging 1.00
R6439:Rec8 UTSW 14 55618619 missense possibly damaging 0.50
Z1088:Rec8 UTSW 14 55625147 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCAGATTGAAGTGAGTTCCCC -3'
(R):5'- AAACCAGCACCTTCTAGGGC -3'

Sequencing Primer
(F):5'- AGATTGAAGTGAGTTCCCCCATCC -3'
(R):5'- GTTCTTCCCTGGATTCTGCAGAAAG -3'
Posted On2017-08-16