Incidental Mutation 'R6115:0610040J01Rik'
ID485067
Institutional Source Beutler Lab
Gene Symbol 0610040J01Rik
Ensembl Gene ENSMUSG00000060512
Gene NameRIKEN cDNA 0610040J01 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R6115 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location63812363-63899625 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 63897974 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Glutamic Acid at position 18 (Q18E)
Ref Sequence ENSEMBL: ENSMUSP00000142539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081747] [ENSMUST00000196367] [ENSMUST00000196575] [ENSMUST00000199667]
Predicted Effect probably damaging
Transcript: ENSMUST00000081747
AA Change: Q18E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080443
Gene: ENSMUSG00000060512
AA Change: Q18E

DomainStartEndE-ValueType
Pfam:DUF4699 9 313 2.5e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196367
AA Change: Q18E

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably damaging
Transcript: ENSMUST00000196575
AA Change: Q18E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect possibly damaging
Transcript: ENSMUST00000199667
AA Change: Q18E

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.186 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf3 T A 8: 122,790,672 H402Q probably damaging Het
Adam34 T G 8: 43,652,061 Q182H probably benign Het
Alx1 G A 10: 103,028,443 P55L possibly damaging Het
Arhgef38 A T 3: 133,132,613 probably null Het
Ccdc102a T C 8: 94,903,371 N514S probably benign Het
Corin T A 5: 72,360,729 T317S probably damaging Het
Ctnna2 A G 6: 77,636,839 V256A probably benign Het
Dhx29 A T 13: 112,952,801 probably null Het
Dnah2 C A 11: 69,446,649 D3209Y probably damaging Het
Dnhd1 A G 7: 105,713,987 T3919A probably benign Het
F7 T A 8: 13,033,958 N214K probably benign Het
Fam3b T G 16: 97,475,368 Q177H possibly damaging Het
Fign T C 2: 63,979,310 I539V probably benign Het
Hc T G 2: 35,013,038 D1067A probably damaging Het
Herc6 A G 6: 57,583,206 D77G probably benign Het
Hmg20a A T 9: 56,489,832 E305D possibly damaging Het
Il16 G A 7: 83,652,567 Q814* probably null Het
Kif13a T A 13: 46,801,313 I648F probably damaging Het
Lactb G T 9: 66,967,687 N374K possibly damaging Het
Lmx1b T C 2: 33,569,106 D145G probably damaging Het
Lrfn4 T C 19: 4,613,909 D199G probably damaging Het
Lrrc49 A T 9: 60,615,161 V307E possibly damaging Het
Magi1 A C 6: 93,708,070 S776A possibly damaging Het
Mthfsl T A 9: 88,688,754 *204L probably null Het
Nsmce4a G T 7: 130,546,992 Q95K probably benign Het
Olfr1281 A G 2: 111,329,213 T265A probably benign Het
Olfr1299 A T 2: 111,664,642 K139* probably null Het
Olfr1449 T C 19: 12,935,584 V282A possibly damaging Het
Olfr344 A T 2: 36,568,951 M118L probably damaging Het
Pcdha7 A G 18: 36,974,735 E271G probably damaging Het
Pcdhga8 T A 18: 37,727,543 F551I possibly damaging Het
Prpf31 T C 7: 3,639,706 probably null Het
Qrfpr C T 3: 36,182,593 V220I possibly damaging Het
Rnf170 T C 8: 26,125,966 F95S possibly damaging Het
Scn9a T A 2: 66,563,629 Y200F possibly damaging Het
Sfpq A T 4: 127,021,348 probably null Het
Slc9c1 A T 16: 45,555,769 Y406F probably damaging Het
Stk32c G T 7: 139,120,712 Y318* probably null Het
Svil A G 18: 5,108,675 R1938G probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tm9sf4 T C 2: 153,182,489 probably null Het
Tmc3 A T 7: 83,614,962 M633L possibly damaging Het
Tmem163 T C 1: 127,677,448 D61G possibly damaging Het
Unc5b C A 10: 60,777,546 A304S probably benign Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Vmn2r18 A T 5: 151,584,997 S221T possibly damaging Het
Vmn2r85 T G 10: 130,422,803 Y461S probably damaging Het
Yod1 T C 1: 130,719,063 F226L possibly damaging Het
Zbtb4 T C 11: 69,776,322 I151T probably damaging Het
Zfp110 A T 7: 12,849,774 Q783L probably damaging Het
Other mutations in 0610040J01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:0610040J01Rik APN 5 63898383 missense possibly damaging 0.79
IGL02229:0610040J01Rik APN 5 63898353 missense probably damaging 0.99
IGL02389:0610040J01Rik APN 5 63896483 missense probably null 1.00
IGL02411:0610040J01Rik APN 5 63898116 missense probably benign 0.31
R0243:0610040J01Rik UTSW 5 63898463 missense probably benign 0.10
R0411:0610040J01Rik UTSW 5 63896491 splice site probably benign
R1978:0610040J01Rik UTSW 5 63898537 nonsense probably null
R2072:0610040J01Rik UTSW 5 63898737 missense possibly damaging 0.83
R2202:0610040J01Rik UTSW 5 63898668 missense possibly damaging 0.91
R3161:0610040J01Rik UTSW 5 63896490 splice site probably benign
R3162:0610040J01Rik UTSW 5 63896490 splice site probably benign
R4428:0610040J01Rik UTSW 5 63898839 missense probably benign
R4429:0610040J01Rik UTSW 5 63898839 missense probably benign
R4430:0610040J01Rik UTSW 5 63898839 missense probably benign
R4431:0610040J01Rik UTSW 5 63898839 missense probably benign
R4464:0610040J01Rik UTSW 5 63898839 missense probably benign
R4465:0610040J01Rik UTSW 5 63898839 missense probably benign
R4467:0610040J01Rik UTSW 5 63898839 missense probably benign
R4491:0610040J01Rik UTSW 5 63898469 missense probably damaging 1.00
R5161:0610040J01Rik UTSW 5 63898001 nonsense probably null
R6273:0610040J01Rik UTSW 5 63898218 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCAGTCACCTGTACTGTG -3'
(R):5'- AGGTAGACCAGTTGTACTGCCTC -3'

Sequencing Primer
(F):5'- GATTAACTAATGACCTGACTTCCCAG -3'
(R):5'- GTACTGCCTCTGCTCTCTGAATTG -3'
Posted OnAug 16, 2017