Incidental Mutation 'R6115:Acsf3'
ID485084
Institutional Source Beutler Lab
Gene Symbol Acsf3
Ensembl Gene ENSMUSG00000015016
Gene Nameacyl-CoA synthetase family member 3
Synonyms
MMRRC Submission 044264-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6115 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location122775486-122817880 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122790672 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 402 (H402Q)
Ref Sequence ENSEMBL: ENSMUSP00000148725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015160] [ENSMUST00000127664] [ENSMUST00000212781] [ENSMUST00000212790]
Predicted Effect probably damaging
Transcript: ENSMUST00000015160
AA Change: H402Q

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000015160
Gene: ENSMUSG00000015016
AA Change: H402Q

DomainStartEndE-ValueType
Pfam:AMP-binding 47 478 3.9e-86 PFAM
Pfam:AMP-binding_C 486 561 6.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212781
AA Change: H402Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000212790
AA Change: H402Q

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212903
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA synthetase family of enzymes that activate fatty acids by catalyzing the formation of a thioester linkage between fatty acids and coenzyme A. The encoded protein is localized to mitochondria, has high specificity for malonate and methylmalonate and possesses malonyl-CoA synthetase activity. Mutations in this gene are a cause of combined malonic and methylmalonic aciduria. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C G 5: 63,897,974 Q18E probably damaging Het
Adam34 T G 8: 43,652,061 Q182H probably benign Het
Alx1 G A 10: 103,028,443 P55L possibly damaging Het
Arhgef38 A T 3: 133,132,613 probably null Het
Ccdc102a T C 8: 94,903,371 N514S probably benign Het
Corin T A 5: 72,360,729 T317S probably damaging Het
Ctnna2 A G 6: 77,636,839 V256A probably benign Het
Dhx29 A T 13: 112,952,801 probably null Het
Dnah2 C A 11: 69,446,649 D3209Y probably damaging Het
Dnhd1 A G 7: 105,713,987 T3919A probably benign Het
F7 T A 8: 13,033,958 N214K probably benign Het
Fam3b T G 16: 97,475,368 Q177H possibly damaging Het
Fign T C 2: 63,979,310 I539V probably benign Het
Hc T G 2: 35,013,038 D1067A probably damaging Het
Herc6 A G 6: 57,583,206 D77G probably benign Het
Hmg20a A T 9: 56,489,832 E305D possibly damaging Het
Il16 G A 7: 83,652,567 Q116* probably null Het
Kif13a T A 13: 46,801,313 I648F probably damaging Het
Lactb G T 9: 66,967,687 N374K possibly damaging Het
Lmx1b T C 2: 33,569,106 D145G probably damaging Het
Lrfn4 T C 19: 4,613,909 D199G probably damaging Het
Lrrc49 A T 9: 60,615,161 V307E possibly damaging Het
Magi1 A C 6: 93,708,070 S776A possibly damaging Het
Mthfsl T A 9: 88,688,754 *147L probably null Het
Nsmce4a G T 7: 130,546,992 Q95K probably benign Het
Olfr1281 A G 2: 111,329,213 T265A probably benign Het
Olfr1299 A T 2: 111,664,642 K139* probably null Het
Olfr1449 T C 19: 12,935,584 V282A possibly damaging Het
Olfr344 A T 2: 36,568,951 M118L probably damaging Het
Pcdha7 A G 18: 36,974,735 E271G probably damaging Het
Pcdhga8 T A 18: 37,727,543 F551I possibly damaging Het
Prpf31 T C 7: 3,639,706 probably null Het
Qrfpr C T 3: 36,182,593 V220I possibly damaging Het
Rnf170 T C 8: 26,125,966 F95S possibly damaging Het
Scn9a T A 2: 66,563,629 Y200F possibly damaging Het
Sfpq A T 4: 127,021,348 probably null Het
Slc9c1 A T 16: 45,555,769 Y406F probably damaging Het
Stk32c G T 7: 139,120,712 Y200* probably null Het
Svil A G 18: 5,108,675 R1938G probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tm9sf4 T C 2: 153,182,489 probably null Het
Tmc3 A T 7: 83,614,962 M633L possibly damaging Het
Tmem163 T C 1: 127,677,448 D61G possibly damaging Het
Unc5b C A 10: 60,777,546 A304S probably benign Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Vmn2r18 A T 5: 151,584,997 S221T possibly damaging Het
Vmn2r85 T G 10: 130,422,803 Y461S probably damaging Het
Yod1 T C 1: 130,719,063 F226L possibly damaging Het
Zbtb4 T C 11: 69,776,322 I151T probably damaging Het
Zfp110 A T 7: 12,849,774 Q783L probably damaging Het
Other mutations in Acsf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Acsf3 APN 8 122780642 splice site probably benign
IGL01930:Acsf3 APN 8 122780346 missense probably benign 0.03
IGL02064:Acsf3 APN 8 122780247 missense possibly damaging 0.74
IGL02321:Acsf3 APN 8 122780114 missense possibly damaging 0.57
IGL02342:Acsf3 APN 8 122817498 missense probably benign 0.03
R0233:Acsf3 UTSW 8 122780292 missense probably damaging 1.00
R0233:Acsf3 UTSW 8 122780292 missense probably damaging 1.00
R0240:Acsf3 UTSW 8 122780181 missense probably damaging 1.00
R0240:Acsf3 UTSW 8 122780181 missense probably damaging 1.00
R0566:Acsf3 UTSW 8 122781527 missense possibly damaging 0.95
R1255:Acsf3 UTSW 8 122785966 critical splice donor site probably null
R1836:Acsf3 UTSW 8 122780183 missense probably damaging 0.99
R1886:Acsf3 UTSW 8 122784002 missense probably damaging 1.00
R1977:Acsf3 UTSW 8 122781533 missense probably damaging 1.00
R2204:Acsf3 UTSW 8 122813644 missense probably damaging 0.98
R4735:Acsf3 UTSW 8 122781479 missense probably damaging 1.00
R4795:Acsf3 UTSW 8 122780157 missense possibly damaging 0.59
R4850:Acsf3 UTSW 8 122817436 missense probably damaging 1.00
R5092:Acsf3 UTSW 8 122817392 missense probably benign 0.12
R5435:Acsf3 UTSW 8 122780281 missense probably damaging 1.00
R6147:Acsf3 UTSW 8 122781474 missense probably damaging 1.00
R6283:Acsf3 UTSW 8 122785955 missense probably damaging 1.00
R6848:Acsf3 UTSW 8 122790590 missense probably damaging 1.00
R7268:Acsf3 UTSW 8 122790662 missense probably benign 0.16
R7291:Acsf3 UTSW 8 122813577 missense probably benign 0.03
R7319:Acsf3 UTSW 8 122813031 missense probably damaging 1.00
R7350:Acsf3 UTSW 8 122785946 missense probably benign 0.00
R7402:Acsf3 UTSW 8 122780424 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAGCACAGTGATCTCAC -3'
(R):5'- TGGACCCTCAAAATGTCCTCC -3'

Sequencing Primer
(F):5'- GTGATCTCACAGTAACCCCATGTC -3'
(R):5'- TCCTCCAGGGACAGAGCTATG -3'
Posted On2017-08-16