Incidental Mutation 'R6116:Hspa8'
ID485123
Institutional Source Beutler Lab
Gene Symbol Hspa8
Ensembl Gene ENSMUSG00000015656
Gene Nameheat shock protein 8
SynonymsHsp73, Hsc71, Hsc70, 2410008N15Rik, Hsc73
MMRRC Submission 044265-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R6116 (G1)
Quality Score191.009
Status Not validated
Chromosome9
Chromosomal Location40800984-40810087 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40804975 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 581 (E581G)
Ref Sequence ENSEMBL: ENSMUSP00000113722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015800] [ENSMUST00000117557] [ENSMUST00000133964]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015800
AA Change: E600G

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000015800
Gene: ENSMUSG00000015656
AA Change: E600G

DomainStartEndE-ValueType
Pfam:HSP70 6 612 2.3e-272 PFAM
Pfam:MreB_Mbl 117 383 5.3e-19 PFAM
low complexity region 613 640 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101927
Predicted Effect probably damaging
Transcript: ENSMUST00000117557
AA Change: E581G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113722
Gene: ENSMUSG00000015656
AA Change: E581G

DomainStartEndE-ValueType
Pfam:HSP70 6 593 3e-255 PFAM
low complexity region 594 621 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117870
SMART Domains Protein: ENSMUSP00000114081
Gene: ENSMUSG00000015656

DomainStartEndE-ValueType
Pfam:HSP70 6 118 2.1e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127699
Predicted Effect probably benign
Transcript: ENSMUST00000133964
SMART Domains Protein: ENSMUSP00000117285
Gene: ENSMUSG00000015656

DomainStartEndE-ValueType
Pfam:HSP70 6 116 2.5e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215526
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heat shock protein 70 family, which contains both heat-inducible and constitutively expressed members. This protein belongs to the latter group, which are also referred to as heat-shock cognate proteins. It functions as a chaperone, and binds to nascent polypeptides to facilitate correct folding. It also functions as an ATPase in the disassembly of clathrin-coated vesicles during transport of membrane components through the cell. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T A 19: 9,012,963 probably benign Het
Apc A T 18: 34,316,455 I2101F probably damaging Het
Bpifa3 G A 2: 154,133,713 V68I possibly damaging Het
Csmd1 T A 8: 16,211,850 I878F probably damaging Het
Cyp2c67 A T 19: 39,617,435 M339K probably damaging Het
Dock3 A G 9: 106,931,962 Y1321H probably damaging Het
Dsc1 G T 18: 20,097,299 D316E probably benign Het
Eno3 C T 11: 70,661,575 T351M possibly damaging Het
Erbb2 T A 11: 98,427,399 F487Y probably damaging Het
Exosc10 T C 4: 148,573,353 L652P probably benign Het
Glmn A T 5: 107,557,340 M470K probably damaging Het
Gm15446 T A 5: 109,943,036 C385S probably damaging Het
Gm597 G A 1: 28,778,699 A84V probably benign Het
Igfn1 T C 1: 135,970,467 D787G probably benign Het
Igkv12-44 T C 6: 69,814,854 T42A possibly damaging Het
Itsn2 T C 12: 4,629,939 probably benign Het
Jade2 T C 11: 51,835,633 E84G probably damaging Het
Lpar3 T A 3: 146,240,597 M10K possibly damaging Het
Lpin2 A G 17: 71,243,930 D695G probably damaging Het
Mosmo T A 7: 120,726,195 L7H probably damaging Het
Ms4a8a C T 19: 11,081,072 A9T unknown Het
Myb T C 10: 21,154,754 D48G probably damaging Het
Neurod6 T C 6: 55,678,791 Y287C probably damaging Het
Olfr878 A G 9: 37,918,659 M1V probably null Het
Olfr96 A G 17: 37,225,568 T148A probably benign Het
Olr1 T A 6: 129,499,984 D106V probably damaging Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Ppfia3 T C 7: 45,354,703 Y505C probably damaging Het
Sdk2 T A 11: 113,854,364 I702F probably damaging Het
Slc16a11 T C 11: 70,215,436 F119L probably benign Het
Slc2a10 A C 2: 165,517,703 T496P probably damaging Het
Slc7a2 T C 8: 40,900,169 Y181H probably damaging Het
Stab2 G T 10: 86,907,190 P1185Q probably damaging Het
Tcf7l2 T A 19: 55,919,014 S335R probably damaging Het
Ttc41 G A 10: 86,759,088 probably null Het
Vmn2r32 A T 7: 7,464,093 I812N probably damaging Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Other mutations in Hspa8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03388:Hspa8 APN 9 40804928 unclassified probably benign
R0006:Hspa8 UTSW 9 40804629 missense probably benign 0.05
R0799:Hspa8 UTSW 9 40803841 missense probably damaging 1.00
R0866:Hspa8 UTSW 9 40802624 critical splice donor site probably null
R3621:Hspa8 UTSW 9 40801923 start codon destroyed probably damaging 0.96
R4475:Hspa8 UTSW 9 40804146 unclassified probably benign
R5096:Hspa8 UTSW 9 40802901 unclassified probably benign
R6363:Hspa8 UTSW 9 40803065 missense probably damaging 1.00
R7067:Hspa8 UTSW 9 40804625 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATGTTCATTCAGAAAAGGGCTGAG -3'
(R):5'- ACAAAGCTACACCTTCTTGGAC -3'

Sequencing Primer
(F):5'- TGAATGGTCCAAACATTCGCG -3'
(R):5'- GACTGACTTAATCCACCTCTTCAATG -3'
Posted On2017-08-16