Incidental Mutation 'R6116:Ttc41'
ID485126
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Nametetratricopeptide repeat domain 41
SynonymsGnn, BC030307
MMRRC Submission 044265-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R6116 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location86705811-86776844 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) G to A at 86759088 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075632]
Predicted Effect probably null
Transcript: ENSMUST00000075632
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219070
Predicted Effect probably benign
Transcript: ENSMUST00000219476
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T A 19: 9,012,963 probably benign Het
Apc A T 18: 34,316,455 I2101F probably damaging Het
Bpifa3 G A 2: 154,133,713 V68I possibly damaging Het
Csmd1 T A 8: 16,211,850 I878F probably damaging Het
Cyp2c67 A T 19: 39,617,435 M339K probably damaging Het
Dock3 A G 9: 106,931,962 Y1321H probably damaging Het
Dsc1 G T 18: 20,097,299 D316E probably benign Het
Eno3 C T 11: 70,661,575 T351M possibly damaging Het
Erbb2 T A 11: 98,427,399 F487Y probably damaging Het
Exosc10 T C 4: 148,573,353 L652P probably benign Het
Glmn A T 5: 107,557,340 M470K probably damaging Het
Gm15446 T A 5: 109,943,036 C385S probably damaging Het
Gm597 G A 1: 28,778,699 A84V probably benign Het
Hspa8 A G 9: 40,804,975 E581G probably damaging Het
Igfn1 T C 1: 135,970,467 D787G probably benign Het
Igkv12-44 T C 6: 69,814,854 T42A possibly damaging Het
Itsn2 T C 12: 4,629,939 probably benign Het
Jade2 T C 11: 51,835,633 E84G probably damaging Het
Lpar3 T A 3: 146,240,597 M10K possibly damaging Het
Lpin2 A G 17: 71,243,930 D695G probably damaging Het
Mosmo T A 7: 120,726,195 L7H probably damaging Het
Ms4a8a C T 19: 11,081,072 A9T unknown Het
Myb T C 10: 21,154,754 D48G probably damaging Het
Neurod6 T C 6: 55,678,791 Y287C probably damaging Het
Olfr878 A G 9: 37,918,659 M1V probably null Het
Olfr96 A G 17: 37,225,568 T148A probably benign Het
Olr1 T A 6: 129,499,984 D106V probably damaging Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Ppfia3 T C 7: 45,354,703 Y505C probably damaging Het
Sdk2 T A 11: 113,854,364 I702F probably damaging Het
Slc16a11 T C 11: 70,215,436 F119L probably benign Het
Slc2a10 A C 2: 165,517,703 T496P probably damaging Het
Slc7a2 T C 8: 40,900,169 Y181H probably damaging Het
Stab2 G T 10: 86,907,190 P1185Q probably damaging Het
Tcf7l2 T A 19: 55,919,014 S335R probably damaging Het
Vmn2r32 A T 7: 7,464,093 I812N probably damaging Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86736933 missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86775957 missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86776678 missense probably benign
IGL01707:Ttc41 APN 10 86776767 missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86731026 missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86776624 missense probably benign 0.03
IGL01918:Ttc41 APN 10 86713190 missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86775951 missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86760914 nonsense probably null
IGL02887:Ttc41 APN 10 86733654 missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86736857 missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86758348 missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86724414 critical splice donor site probably null
IGL03242:Ttc41 APN 10 86776819 makesense probably null
IGL03307:Ttc41 APN 10 86744440 missense possibly damaging 0.76
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0379:Ttc41 UTSW 10 86712977 missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86763947 missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86759097 missense probably benign 0.00
R1589:Ttc41 UTSW 10 86776390 missense probably benign 0.01
R1599:Ttc41 UTSW 10 86776573 missense probably benign 0.04
R1608:Ttc41 UTSW 10 86775993 missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86776252 missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86776214 missense probably benign
R2398:Ttc41 UTSW 10 86713386 missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86724374 missense probably benign 0.42
R3117:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86729798 missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4841:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4842:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4884:Ttc41 UTSW 10 86731018 missense probably benign 0.00
R4885:Ttc41 UTSW 10 86759102 missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86776192 missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86744544 missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86730942 missense probably benign 0.13
R5268:Ttc41 UTSW 10 86744478 missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86776579 missense probably benign 0.04
R5301:Ttc41 UTSW 10 86719520 missense probably benign 0.00
R5425:Ttc41 UTSW 10 86776630 missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86760920 critical splice donor site probably null
R5635:Ttc41 UTSW 10 86736977 missense probably benign 0.09
R5752:Ttc41 UTSW 10 86758346 missense probably benign 0.33
R5868:Ttc41 UTSW 10 86750264 missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86713224 missense probably damaging 1.00
R6247:Ttc41 UTSW 10 86776663 missense probably benign 0.00
R6260:Ttc41 UTSW 10 86731159 missense probably benign 0.20
R6260:Ttc41 UTSW 10 86733707 missense probably benign 0.32
R6276:Ttc41 UTSW 10 86744449 missense probably benign 0.01
R6458:Ttc41 UTSW 10 86758270 missense possibly damaging 0.45
X0024:Ttc41 UTSW 10 86724250 missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86729797 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTCAGGTTCACACTGTTGTC -3'
(R):5'- TCAGAAAACAAGAGAAATGTTCATGCT -3'

Sequencing Primer
(F):5'- GACTGACACTTGCATACAGATG -3'
(R):5'- TGCTTACATGAGAACACCTTCAG -3'
Posted On2017-08-16