Incidental Mutation 'R6116:Eno3'
ID485130
Institutional Source Beutler Lab
Gene Symbol Eno3
Ensembl Gene ENSMUSG00000060600
Gene Nameenolase 3, beta muscle
SynonymsEno-3
MMRRC Submission 044265-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R6116 (G1)
Quality Score190.009
Status Not validated
Chromosome11
Chromosomal Location70657202-70662513 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70661575 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 351 (T351M)
Ref Sequence ENSEMBL: ENSMUSP00000128714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018431] [ENSMUST00000072841] [ENSMUST00000108548] [ENSMUST00000126241] [ENSMUST00000129434] [ENSMUST00000134087] [ENSMUST00000157027] [ENSMUST00000170716]
Predicted Effect probably benign
Transcript: ENSMUST00000018431
SMART Domains Protein: ENSMUSP00000018431
Gene: ENSMUSG00000018287

DomainStartEndE-ValueType
R3H 31 109 3.85e-21 SMART
low complexity region 130 152 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000072841
AA Change: T351M

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000072620
Gene: ENSMUSG00000060600
AA Change: T351M

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Enolase_C 142 431 8.8e-200 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108548
AA Change: T351M

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104188
Gene: ENSMUSG00000060600
AA Change: T351M

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Enolase_C 142 431 8.8e-200 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124691
Predicted Effect probably benign
Transcript: ENSMUST00000126241
SMART Domains Protein: ENSMUSP00000123688
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 70 7.82e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129434
SMART Domains Protein: ENSMUSP00000115098
Gene: ENSMUSG00000018287

DomainStartEndE-ValueType
R3H 22 99 3.06e-15 SMART
low complexity region 120 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134087
SMART Domains Protein: ENSMUSP00000121640
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 78 3.53e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137691
Predicted Effect probably benign
Transcript: ENSMUST00000157027
SMART Domains Protein: ENSMUSP00000115726
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Pfam:Enolase_C 142 196 1e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170716
AA Change: T351M

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128714
Gene: ENSMUSG00000060600
AA Change: T351M

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Enolase_C 142 431 8.8e-200 SMART
Predicted Effect unknown
Transcript: ENSMUST00000179055
AA Change: T131M
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179738
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes one of the three enolase isoenzymes found in vertebrates. Enolase is a dimeric enzyme that converts 2-phosphoglycerate to phosphoenolpyruvate as part of the glycolytic pathway. This isozyme is found in skeletal muscle where it is involved in muscle development and regeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T A 19: 9,012,963 probably benign Het
Apc A T 18: 34,316,455 I2101F probably damaging Het
Bpifa3 G A 2: 154,133,713 V68I possibly damaging Het
Csmd1 T A 8: 16,211,850 I878F probably damaging Het
Cyp2c67 A T 19: 39,617,435 M339K probably damaging Het
Dock3 A G 9: 106,931,962 Y1321H probably damaging Het
Dsc1 G T 18: 20,097,299 D316E probably benign Het
Erbb2 T A 11: 98,427,399 F487Y probably damaging Het
Exosc10 T C 4: 148,573,353 L652P probably benign Het
Glmn A T 5: 107,557,340 M470K probably damaging Het
Gm15446 T A 5: 109,943,036 C385S probably damaging Het
Gm597 G A 1: 28,778,699 A84V probably benign Het
Hspa8 A G 9: 40,804,975 E581G probably damaging Het
Igfn1 T C 1: 135,970,467 D787G probably benign Het
Igkv12-44 T C 6: 69,814,854 T42A possibly damaging Het
Itsn2 T C 12: 4,629,939 probably benign Het
Jade2 T C 11: 51,835,633 E84G probably damaging Het
Lpar3 T A 3: 146,240,597 M10K possibly damaging Het
Lpin2 A G 17: 71,243,930 D695G probably damaging Het
Mosmo T A 7: 120,726,195 L7H probably damaging Het
Ms4a8a C T 19: 11,081,072 A9T unknown Het
Myb T C 10: 21,154,754 D48G probably damaging Het
Neurod6 T C 6: 55,678,791 Y287C probably damaging Het
Olfr878 A G 9: 37,918,659 M1V probably null Het
Olfr96 A G 17: 37,225,568 T148A probably benign Het
Olr1 T A 6: 129,499,984 D106V probably damaging Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Ppfia3 T C 7: 45,354,703 Y505C probably damaging Het
Sdk2 T A 11: 113,854,364 I702F probably damaging Het
Slc16a11 T C 11: 70,215,436 F119L probably benign Het
Slc2a10 A C 2: 165,517,703 T496P probably damaging Het
Slc7a2 T C 8: 40,900,169 Y181H probably damaging Het
Stab2 G T 10: 86,907,190 P1185Q probably damaging Het
Tcf7l2 T A 19: 55,919,014 S335R probably damaging Het
Ttc41 G A 10: 86,759,088 probably null Het
Vmn2r32 A T 7: 7,464,093 I812N probably damaging Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Other mutations in Eno3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02479:Eno3 APN 11 70660888 splice site probably benign
IGL02591:Eno3 APN 11 70662027 missense probably damaging 1.00
IGL02868:Eno3 APN 11 70662000 missense probably damaging 1.00
R0242:Eno3 UTSW 11 70657935 missense probably null 1.00
R0242:Eno3 UTSW 11 70657935 missense probably null 1.00
R0970:Eno3 UTSW 11 70660802 missense probably damaging 1.00
R1518:Eno3 UTSW 11 70661077 nonsense probably null
R1587:Eno3 UTSW 11 70661470 missense probably damaging 0.99
R1663:Eno3 UTSW 11 70662274 critical splice donor site probably null
R1675:Eno3 UTSW 11 70658666 critical splice donor site probably null
R1758:Eno3 UTSW 11 70661425 missense possibly damaging 0.77
R3983:Eno3 UTSW 11 70661411 missense probably damaging 0.98
R4990:Eno3 UTSW 11 70658647 missense probably damaging 0.99
R4992:Eno3 UTSW 11 70658647 missense probably damaging 0.99
R5170:Eno3 UTSW 11 70662214 missense probably benign 0.00
R6917:Eno3 UTSW 11 70661436 missense probably benign
R7060:Eno3 UTSW 11 70661419 missense possibly damaging 0.95
R7128:Eno3 UTSW 11 70658604 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- ATCAGGCCCCTGTCTCTAAC -3'
(R):5'- AAGTCTTAGAGCCAAGTTGGG -3'

Sequencing Primer
(F):5'- TACCAGTGGTCTCCATTGAGGAC -3'
(R):5'- CCAAGTTGGGGGTCAGTCATAG -3'
Posted On2017-08-16