Incidental Mutation 'R6117:Agbl1'
ID485158
Institutional Source Beutler Lab
Gene Symbol Agbl1
Ensembl Gene ENSMUSG00000025754
Gene NameATP/GTP binding protein-like 1
SynonymsNna1-l1, EG244071
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001199224.1; MGI:3646469

Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R6117 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location76229887-77124698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76698786 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 625 (Y625C)
Ref Sequence ENSEMBL: ENSMUSP00000103066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026854] [ENSMUST00000107442] [ENSMUST00000156166]
Predicted Effect probably damaging
Transcript: ENSMUST00000026854
AA Change: Y625C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026854
Gene: ENSMUSG00000025754
AA Change: Y625C

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Pfam:Peptidase_M14 493 631 4.4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107442
AA Change: Y625C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103066
Gene: ENSMUSG00000025754
AA Change: Y625C

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Pfam:Peptidase_M14 494 754 3.1e-27 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000156166
AA Change: Y877C
SMART Domains Protein: ENSMUSP00000119721
Gene: ENSMUSG00000025754
AA Change: Y877C

DomainStartEndE-ValueType
low complexity region 254 270 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206401
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyglutamylation is a reversible posttranslational modification catalyzed by polyglutamylases that results in the addition of glutamate side chains on the modified protein. This gene encodes a glutamate decarboxylase that catalyzes the deglutamylation of polyglutamylated proteins. Mutations in this gene result in dominant late-onset Fuchs corneal dystrophy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankmy1 A G 1: 92,861,274 probably benign Het
Apmap T C 2: 150,600,332 T41A probably benign Het
Cacna1a A G 8: 84,614,721 Y1804C probably damaging Het
Cacna1e A T 1: 154,561,791 I333N possibly damaging Het
Cdsn C A 17: 35,555,034 S153R unknown Het
Celsr1 A T 15: 85,932,411 M1777K probably benign Het
Cmtr1 A G 17: 29,682,165 M249V probably benign Het
Cmya5 A G 13: 93,095,166 L1138P probably damaging Het
Crim1 A C 17: 78,303,088 D324A probably damaging Het
Dmap1 T A 4: 117,675,535 probably null Het
Dnah17 T C 11: 118,119,571 Y307C probably benign Het
Dnah5 T A 15: 28,270,420 L956H probably damaging Het
Enpp3 C T 10: 24,787,852 S537N probably damaging Het
Eya3 T A 4: 132,711,862 L323Q probably damaging Het
Fads3 A T 19: 10,054,267 H226L probably damaging Het
Flrt3 T A 2: 140,660,445 D421V possibly damaging Het
Frmd4a T C 2: 4,602,249 V370A possibly damaging Het
Gapvd1 T C 2: 34,690,459 probably null Het
Gm2178 T C 14: 26,514,840 probably benign Het
Gm5592 A G 7: 41,288,464 N390S probably benign Het
Hoxa10 T A 6: 52,234,820 R39* probably null Het
Kcnj1 A G 9: 32,397,182 T281A probably damaging Het
Myo10 T C 15: 25,805,659 Y1709H probably benign Het
Nacad T C 11: 6,599,810 D1127G probably benign Het
Naip1 T A 13: 100,444,737 M1L probably damaging Het
Olfr1331 A T 4: 118,869,144 Y121F probably benign Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Pcdhb12 G A 18: 37,435,642 probably benign Het
Pde1b T C 15: 103,521,482 V134A probably damaging Het
Plxnb2 A T 15: 89,158,000 D1600E probably benign Het
Prss54 T A 8: 95,565,458 probably null Het
Ryr3 A T 2: 112,635,396 I4757N probably damaging Het
Slc1a6 T C 10: 78,788,988 Y76H possibly damaging Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Sox15 G T 11: 69,655,890 G173V possibly damaging Het
Stard3 T C 11: 98,372,262 S48P probably damaging Het
Stk32c G A 7: 139,122,923 Q67* probably null Het
Svil T A 18: 5,116,016 W2101R probably damaging Het
Taar7e T A 10: 24,038,529 Y306N probably damaging Het
Tarbp1 T A 8: 126,427,541 M1485L probably benign Het
Togaram1 A G 12: 64,967,487 D504G probably damaging Het
Trrap T C 5: 144,802,961 L1091S possibly damaging Het
Unc80 A G 1: 66,675,067 E2856G possibly damaging Het
Usp47 C T 7: 112,087,932 T699M probably damaging Het
Other mutations in Agbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01567:Agbl1 APN 7 76421880 missense probably benign 0.01
IGL01650:Agbl1 APN 7 76420319 missense probably damaging 1.00
IGL02244:Agbl1 APN 7 76766372 missense probably damaging 1.00
IGL03088:Agbl1 APN 7 76720142 missense probably benign 0.12
IGL03143:Agbl1 APN 7 76420045 nonsense probably null
IGL03306:Agbl1 APN 7 76589504 missense probably damaging 1.00
R0001:Agbl1 UTSW 7 76419863 missense probably damaging 0.98
R0045:Agbl1 UTSW 7 76698840 critical splice donor site probably null
R0045:Agbl1 UTSW 7 76698840 critical splice donor site probably null
R0541:Agbl1 UTSW 7 76409245 missense probably benign 0.22
R1889:Agbl1 UTSW 7 76589381 missense probably damaging 1.00
R2089:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2127:Agbl1 UTSW 7 76419880 missense possibly damaging 0.64
R2148:Agbl1 UTSW 7 76414717 splice site probably null
R2229:Agbl1 UTSW 7 76433378 missense probably benign 0.43
R2243:Agbl1 UTSW 7 76418722 missense possibly damaging 0.93
R2255:Agbl1 UTSW 7 76422184 missense probably damaging 1.00
R2411:Agbl1 UTSW 7 76720150 missense probably damaging 1.00
R2426:Agbl1 UTSW 7 76421902 missense probably damaging 1.00
R2508:Agbl1 UTSW 7 76589550 critical splice donor site probably null
R2910:Agbl1 UTSW 7 76419838 missense probably benign 0.13
R2919:Agbl1 UTSW 7 76414658 missense probably damaging 1.00
R3056:Agbl1 UTSW 7 76766484 missense possibly damaging 0.60
R3153:Agbl1 UTSW 7 76720196 missense probably damaging 1.00
R3770:Agbl1 UTSW 7 76425929 critical splice donor site probably null
R3825:Agbl1 UTSW 7 76419967 missense probably damaging 0.99
R4632:Agbl1 UTSW 7 76413685 missense probably benign 0.00
R4857:Agbl1 UTSW 7 76419835 missense probably benign 0.03
R4943:Agbl1 UTSW 7 76420016 missense probably benign 0.01
R5055:Agbl1 UTSW 7 76413577 missense probably damaging 1.00
R5071:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5072:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5074:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5095:Agbl1 UTSW 7 76720133 missense probably damaging 0.96
R5133:Agbl1 UTSW 7 76422156 missense probably benign 0.21
R5576:Agbl1 UTSW 7 76335237 missense probably benign 0.03
R5665:Agbl1 UTSW 7 76589503 missense probably damaging 1.00
R5849:Agbl1 UTSW 7 76325098 missense probably benign 0.35
R5924:Agbl1 UTSW 7 76409234 missense probably benign 0.12
R6044:Agbl1 UTSW 7 76318120 missense possibly damaging 0.56
R6144:Agbl1 UTSW 7 76420084 missense probably benign 0.02
R6368:Agbl1 UTSW 7 76419830 missense probably benign 0.25
R6806:Agbl1 UTSW 7 76425921 missense probably damaging 1.00
Z1088:Agbl1 UTSW 7 76419904 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGATCTGCAGCTTCCTG -3'
(R):5'- AAAGTTTCCCACATATGTTTGTCCC -3'

Sequencing Primer
(F):5'- AGCTTCCTGGACATCTGGAG -3'
(R):5'- CCACATATGTTTGTCCCCTTTG -3'
Posted On2017-08-16