Incidental Mutation 'R6118:Tpp2'
ID485191
Institutional Source Beutler Lab
Gene Symbol Tpp2
Ensembl Gene ENSMUSG00000041763
Gene Nametripeptidyl peptidase II
SynonymsTppII
MMRRC Submission 044267-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.636) question?
Stock #R6118 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location43933647-44003000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43940146 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 68 (I68F)
Ref Sequence ENSEMBL: ENSMUSP00000140474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087933] [ENSMUST00000188302] [ENSMUST00000188313] [ENSMUST00000189388]
Predicted Effect probably benign
Transcript: ENSMUST00000087933
AA Change: I68F

PolyPhen 2 Score 0.398 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000085244
Gene: ENSMUSG00000041763
AA Change: I68F

DomainStartEndE-ValueType
Pfam:Peptidase_S8 35 500 1.4e-96 PFAM
low complexity region 674 685 N/A INTRINSIC
Pfam:TPPII 777 964 2.4e-80 PFAM
low complexity region 1017 1033 N/A INTRINSIC
PDB:3LXU|X 1034 1262 1e-20 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186028
Predicted Effect probably damaging
Transcript: ENSMUST00000188302
AA Change: I68F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140474
Gene: ENSMUSG00000041763
AA Change: I68F

DomainStartEndE-ValueType
Pfam:Peptidase_S8 39 509 4.3e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188313
AA Change: I68F

PolyPhen 2 Score 0.398 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139918
Gene: ENSMUSG00000041763
AA Change: I68F

DomainStartEndE-ValueType
Pfam:Peptidase_S8 39 509 5.1e-83 PFAM
low complexity region 674 685 N/A INTRINSIC
Pfam:TPPII 773 966 2.7e-93 PFAM
low complexity region 1004 1020 N/A INTRINSIC
PDB:3LXU|X 1021 1249 1e-20 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000189388
AA Change: I68F

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140562
Gene: ENSMUSG00000041763
AA Change: I68F

DomainStartEndE-ValueType
Pfam:Peptidase_S8 39 509 2.3e-81 PFAM
low complexity region 674 685 N/A INTRINSIC
Pfam:TPPII 773 880 7.8e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190401
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mammalian peptidase that, at neutral pH, removes tripeptides from the N terminus of longer peptides. The protein has a specialized function that is essential for some MHC class I antigen presentation. The protein is a high molecular mass serine exopeptidase; the amino acid sequence surrounding the serine residue at the active site is similar to the peptidases of the subtilisin class rather than the trypsin class. [provided by RefSeq, Jul 2008]
PHENOTYPE: Engineered mutations of this gene result in decreased lifespan and symptoms of immunohematopoietic senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,431,291 K316N probably damaging Het
Als2 A T 1: 59,203,069 V609E possibly damaging Het
Ank3 A G 10: 69,994,401 I71V probably damaging Het
Antxr2 T A 5: 97,949,201 D351V probably damaging Het
Arel1 A G 12: 84,941,939 V12A possibly damaging Het
Atad1 C T 19: 32,687,297 R239H possibly damaging Het
B3galnt2 A G 13: 13,991,509 T330A probably damaging Het
Bag6 T A 17: 35,143,624 I636N probably damaging Het
C1qtnf6 T C 15: 78,525,395 D84G probably damaging Het
Ceacam20 T C 7: 19,971,729 V215A possibly damaging Het
Chtf18 C T 17: 25,719,159 D967N probably damaging Het
Cntnap2 T A 6: 47,193,077 I1159K possibly damaging Het
Col2a1 T C 15: 97,998,567 D67G unknown Het
Csde1 T A 3: 103,054,754 V627E probably benign Het
Epb41l1 G A 2: 156,522,477 E969K probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gabbr2 C T 4: 46,736,459 R474Q probably damaging Het
Hap1 G T 11: 100,355,794 T95N probably benign Het
Hist2h2bb T A 3: 96,269,951 V67E probably damaging Het
Jmjd1c A G 10: 67,240,012 K1886R probably damaging Het
Kndc1 A G 7: 139,923,802 D1007G probably damaging Het
Mcm2 C T 6: 88,887,836 A553T probably damaging Het
Memo1 T C 17: 74,202,307 Y239C possibly damaging Het
Meox2 GCACCACCACCACCACCACCA GCACCACCACCACCACCA 12: 37,109,031 probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Obsl1 A G 1: 75,492,078 probably benign Het
Olfr1082 T A 2: 86,594,414 H138L probably benign Het
Olfr1212 T A 2: 88,959,118 Y217* probably null Het
Pold3 A G 7: 100,096,407 S180P possibly damaging Het
Rbm12b2 T C 4: 12,095,135 S665P probably benign Het
Rfc4 A T 16: 23,120,943 S86T probably damaging Het
Rfx6 T A 10: 51,711,866 N277K possibly damaging Het
Ryr2 C A 13: 11,792,689 V865F possibly damaging Het
Skint4 T A 4: 112,119,822 probably null Het
Slc38a10 T C 11: 120,132,843 Y249C probably damaging Het
Slco1b2 A G 6: 141,657,510 T206A probably benign Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Tbc1d1 C T 5: 64,284,037 L655F probably damaging Het
Trim30c G T 7: 104,382,081 T509K probably benign Het
Zfp827 G T 8: 79,076,438 K546N possibly damaging Het
Other mutations in Tpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Tpp2 APN 1 43983291 missense possibly damaging 0.90
IGL01021:Tpp2 APN 1 43934187 nonsense probably null
IGL01096:Tpp2 APN 1 43960888 missense probably damaging 1.00
IGL01344:Tpp2 APN 1 43983262 missense probably benign 0.04
IGL01642:Tpp2 APN 1 43954653 missense probably damaging 1.00
IGL02719:Tpp2 APN 1 43940231 missense probably benign 0.09
IGL02890:Tpp2 APN 1 43999690 missense probably damaging 1.00
IGL03102:Tpp2 APN 1 43956489 missense probably damaging 1.00
IGL03175:Tpp2 APN 1 43973511 missense probably benign 0.35
beaver UTSW 1 43971715 missense probably benign 0.08
cleaver UTSW 1 43978508 nonsense probably null
June UTSW 1 43954710 missense probably damaging 1.00
state UTSW 1 43978438 missense possibly damaging 0.48
wally UTSW 1 43992396 critical splice donor site probably null
Ward UTSW 1 43954736 missense possibly damaging 0.82
R0001:Tpp2 UTSW 1 43971726 missense probably benign 0.00
R0003:Tpp2 UTSW 1 43960139 missense possibly damaging 0.94
R0066:Tpp2 UTSW 1 43981748 missense possibly damaging 0.56
R0110:Tpp2 UTSW 1 43999693 missense probably damaging 1.00
R0110:Tpp2 UTSW 1 43978504 missense probably benign 0.00
R0167:Tpp2 UTSW 1 43970488 missense probably benign 0.01
R0441:Tpp2 UTSW 1 43990562 missense possibly damaging 0.85
R0520:Tpp2 UTSW 1 43990530 missense probably damaging 1.00
R0639:Tpp2 UTSW 1 43975447 missense probably benign 0.00
R1118:Tpp2 UTSW 1 43992396 critical splice donor site probably null
R1119:Tpp2 UTSW 1 43992396 critical splice donor site probably null
R1593:Tpp2 UTSW 1 43975433 missense probably benign 0.01
R1702:Tpp2 UTSW 1 43990548 missense probably damaging 0.99
R1756:Tpp2 UTSW 1 43978725 splice site probably null
R2066:Tpp2 UTSW 1 43978438 missense possibly damaging 0.48
R2171:Tpp2 UTSW 1 43957446 missense probably benign 0.00
R2378:Tpp2 UTSW 1 43999765 missense probably damaging 0.99
R2394:Tpp2 UTSW 1 43983186 missense possibly damaging 0.83
R2507:Tpp2 UTSW 1 44001449 missense probably benign 0.31
R2879:Tpp2 UTSW 1 43971623 missense probably damaging 1.00
R3436:Tpp2 UTSW 1 43940144 missense probably damaging 0.99
R4106:Tpp2 UTSW 1 44001457 missense possibly damaging 0.71
R4658:Tpp2 UTSW 1 43954710 missense probably damaging 1.00
R4760:Tpp2 UTSW 1 43971715 missense probably benign 0.08
R4963:Tpp2 UTSW 1 43992268 missense probably damaging 1.00
R5049:Tpp2 UTSW 1 44001473 missense possibly damaging 0.46
R5073:Tpp2 UTSW 1 43954736 missense possibly damaging 0.82
R6010:Tpp2 UTSW 1 43951213 critical splice donor site probably null
R6155:Tpp2 UTSW 1 43956489 missense probably damaging 1.00
R6169:Tpp2 UTSW 1 43983579 missense probably damaging 0.99
R6236:Tpp2 UTSW 1 43977317 missense probably benign 0.01
R6695:Tpp2 UTSW 1 43983276 missense probably benign
R6845:Tpp2 UTSW 1 43978508 nonsense probably null
R7054:Tpp2 UTSW 1 43983158 missense probably damaging 1.00
R7094:Tpp2 UTSW 1 43968988 missense probably damaging 1.00
R7223:Tpp2 UTSW 1 43968888 missense probably damaging 1.00
R7316:Tpp2 UTSW 1 43970431 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTGCTATATCCAACACCTAAAAGG -3'
(R):5'- GTAACAGGTAAACACTACTATCCTGC -3'

Sequencing Primer
(F):5'- CATAGGGATTTGCATTGCAT -3'
(R):5'- GTTCCAACCTTAAGCACTC -3'
Posted On2017-08-16