Mutagenetix > Incidental Mutation

Incidental Mutation 'R6118:Cntnap2'

485205

Institutional Source

Beutler Lab

Gene Symbol

Cntnap2

Ensembl Gene

ENSMUSG00000039419

Gene Name

contactin associated protein-like 2

Synonyms

Caspr2, 5430425M22Rik

MMRRC Submission

044267-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6118 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

45036995-47278330 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 47170011 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 1159 (I1159K)

Ref Sequence

ENSEMBL: ENSMUSP00000110288 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114641]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114641
AA Change: I1159K

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: I1159K

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	34	181	3.99e-22	SMART
LamG	208	345	5.5e-34	SMART
LamG	393	529	3.31e-28	SMART
EGF	557	591	5.04e-2	SMART
Blast:FBG	594	777	7e-68	BLAST
LamG	819	945	5.58e-35	SMART
EGF	966	1002	2.11e1	SMART
LamG	1048	1188	3.55e-28	SMART
low complexity region	1263	1273	N/A	INTRINSIC
4.1m	1283	1301	4.21e-7	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	T	G	10: 10,307,035 (GRCm39)	K316N	probably damaging	Het
Als2	A	T	1: 59,242,228 (GRCm39)	V609E	possibly damaging	Het
Ank3	A	G	10: 69,830,231 (GRCm39)	I71V	probably damaging	Het
Antxr2	T	A	5: 98,097,060 (GRCm39)	D351V	probably damaging	Het
Arel1	A	G	12: 84,988,713 (GRCm39)	V12A	possibly damaging	Het
Atad1	C	T	19: 32,664,697 (GRCm39)	R239H	possibly damaging	Het
B3galnt2	A	G	13: 14,166,094 (GRCm39)	T330A	probably damaging	Het
Bag6	T	A	17: 35,362,600 (GRCm39)	I636N	probably damaging	Het
C1qtnf6	T	C	15: 78,409,595 (GRCm39)	D84G	probably damaging	Het
Ceacam20	T	C	7: 19,705,654 (GRCm39)	V215A	possibly damaging	Het
Chtf18	C	T	17: 25,938,133 (GRCm39)	D967N	probably damaging	Het
Col2a1	T	C	15: 97,896,448 (GRCm39)	D67G	unknown	Het
Csde1	T	A	3: 102,962,070 (GRCm39)	V627E	probably benign	Het
Epb41l1	G	A	2: 156,364,397 (GRCm39)	E969K	probably benign	Het
Fam53c	A	C	18: 34,901,743 (GRCm39)	E220A	probably damaging	Het
Gabbr2	C	T	4: 46,736,459 (GRCm39)	R474Q	probably damaging	Het
H2bc18	T	A	3: 96,177,267 (GRCm39)	V67E	probably damaging	Het
Hap1	G	T	11: 100,246,620 (GRCm39)	T95N	probably benign	Het
Jmjd1c	A	G	10: 67,075,791 (GRCm39)	K1886R	probably damaging	Het
Kndc1	A	G	7: 139,503,717 (GRCm39)	D1007G	probably damaging	Het
Mcm2	C	T	6: 88,864,818 (GRCm39)	A553T	probably damaging	Het
Memo1	T	C	17: 74,509,302 (GRCm39)	Y239C	possibly damaging	Het
Meox2	GCACCACCACCACCACCACCA	GCACCACCACCACCACCA	12: 37,159,030 (GRCm39)		probably benign	Het
Mptx2	G	A	1: 173,102,414 (GRCm39)	L92F	probably benign	Het
Obsl1	A	G	1: 75,468,722 (GRCm39)		probably benign	Het
Or4c107	T	A	2: 88,789,462 (GRCm39)	Y217*	probably null	Het
Or8k35	T	A	2: 86,424,758 (GRCm39)	H138L	probably benign	Het
Pold3	A	G	7: 99,745,614 (GRCm39)	S180P	possibly damaging	Het
Rbm12b2	T	C	4: 12,095,135 (GRCm39)	S665P	probably benign	Het
Rfc4	A	T	16: 22,939,693 (GRCm39)	S86T	probably damaging	Het
Rfx6	T	A	10: 51,587,962 (GRCm39)	N277K	possibly damaging	Het
Ryr2	C	A	13: 11,807,575 (GRCm39)	V865F	possibly damaging	Het
Skint4	T	A	4: 111,977,019 (GRCm39)		probably null	Het
Slc38a10	T	C	11: 120,023,669 (GRCm39)	Y249C	probably damaging	Het
Slco1b2	A	G	6: 141,603,236 (GRCm39)	T206A	probably benign	Het
Slco3a1	C	T	7: 73,968,254 (GRCm39)	D489N	probably benign	Het
Tasor2	C	T	13: 3,631,891 (GRCm39)	R870H	possibly damaging	Het
Tbc1d1	C	T	5: 64,441,380 (GRCm39)	L655F	probably damaging	Het
Tpp2	A	T	1: 43,979,306 (GRCm39)	I68F	probably damaging	Het
Trim30c	G	T	7: 104,031,288 (GRCm39)	T509K	probably benign	Het
Zfp827	G	T	8: 79,803,067 (GRCm39)	K546N	possibly damaging	Het

Other mutations in Cntnap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Cntnap2	APN	6	45,992,197 (GRCm39)	missense	possibly damaging	0.92
IGL00657:Cntnap2	APN	6	46,965,721 (GRCm39)	missense	probably damaging	0.98
IGL00846:Cntnap2	APN	6	47,169,972 (GRCm39)	missense	probably benign	0.12
IGL00851:Cntnap2	APN	6	46,461,006 (GRCm39)	missense	probably benign
IGL00857:Cntnap2	APN	6	47,026,358 (GRCm39)	missense	probably benign	0.00
IGL01290:Cntnap2	APN	6	45,992,399 (GRCm39)	missense	probably benign	0.06
IGL01445:Cntnap2	APN	6	47,169,947 (GRCm39)	missense	probably benign	0.14
IGL01468:Cntnap2	APN	6	47,248,305 (GRCm39)	nonsense	probably null
IGL01859:Cntnap2	APN	6	46,965,655 (GRCm39)	missense	probably damaging	1.00
IGL02092:Cntnap2	APN	6	46,211,137 (GRCm39)	missense	probably damaging	1.00
IGL02239:Cntnap2	APN	6	46,998,588 (GRCm39)	missense	probably damaging	0.99
IGL02508:Cntnap2	APN	6	46,211,254 (GRCm39)	missense	probably damaging	1.00
IGL02530:Cntnap2	APN	6	46,998,670 (GRCm39)	missense	possibly damaging	0.48
IGL03013:Cntnap2	APN	6	47,072,483 (GRCm39)	missense	possibly damaging	0.66
BB004:Cntnap2	UTSW	6	47,072,621 (GRCm39)	missense	possibly damaging	0.93
BB014:Cntnap2	UTSW	6	47,072,621 (GRCm39)	missense	possibly damaging	0.93
IGL02802:Cntnap2	UTSW	6	46,147,179 (GRCm39)	missense	probably damaging	1.00
R0001:Cntnap2	UTSW	6	46,507,105 (GRCm39)	missense	probably benign	0.04
R0007:Cntnap2	UTSW	6	45,969,007 (GRCm39)	missense	possibly damaging	0.95
R0007:Cntnap2	UTSW	6	45,969,007 (GRCm39)	missense	possibly damaging	0.95
R0043:Cntnap2	UTSW	6	46,460,917 (GRCm39)	missense	probably benign	0.01
R0118:Cntnap2	UTSW	6	45,037,326 (GRCm39)	splice site	probably null
R0352:Cntnap2	UTSW	6	45,969,018 (GRCm39)	splice site	probably null
R0389:Cntnap2	UTSW	6	45,986,571 (GRCm39)	missense	probably benign	0.06
R0482:Cntnap2	UTSW	6	45,692,750 (GRCm39)	missense	probably benign	0.00
R0530:Cntnap2	UTSW	6	46,506,839 (GRCm39)	nonsense	probably null
R0611:Cntnap2	UTSW	6	47,072,483 (GRCm39)	missense	possibly damaging	0.66
R0630:Cntnap2	UTSW	6	46,965,694 (GRCm39)	missense	probably damaging	0.99
R0636:Cntnap2	UTSW	6	47,273,642 (GRCm39)	splice site	probably benign
R0976:Cntnap2	UTSW	6	47,248,164 (GRCm39)	missense	probably damaging	1.00
R1195:Cntnap2	UTSW	6	46,460,902 (GRCm39)	missense	probably benign
R1195:Cntnap2	UTSW	6	46,460,902 (GRCm39)	missense	probably benign
R1195:Cntnap2	UTSW	6	46,460,902 (GRCm39)	missense	probably benign
R1387:Cntnap2	UTSW	6	47,084,848 (GRCm39)	missense	probably benign	0.19
R1524:Cntnap2	UTSW	6	46,507,613 (GRCm39)	missense	probably damaging	1.00
R1609:Cntnap2	UTSW	6	45,992,264 (GRCm39)	missense	probably benign	0.13
R1716:Cntnap2	UTSW	6	47,084,826 (GRCm39)	nonsense	probably null
R1757:Cntnap2	UTSW	6	46,736,763 (GRCm39)	missense	probably damaging	1.00
R1809:Cntnap2	UTSW	6	46,965,609 (GRCm39)	missense	probably damaging	0.99
R1813:Cntnap2	UTSW	6	46,507,567 (GRCm39)	missense	probably damaging	1.00
R2103:Cntnap2	UTSW	6	47,275,522 (GRCm39)	missense	probably damaging	1.00
R2133:Cntnap2	UTSW	6	47,275,379 (GRCm39)	missense	probably damaging	1.00
R3037:Cntnap2	UTSW	6	45,992,200 (GRCm39)	missense	possibly damaging	0.57
R3899:Cntnap2	UTSW	6	45,968,837 (GRCm39)	missense	probably benign	0.00
R4027:Cntnap2	UTSW	6	46,833,062 (GRCm39)	missense	probably benign
R4030:Cntnap2	UTSW	6	46,833,062 (GRCm39)	missense	probably benign
R4237:Cntnap2	UTSW	6	46,507,324 (GRCm39)	intron	probably benign
R4445:Cntnap2	UTSW	6	46,736,785 (GRCm39)	missense	probably benign	0.01
R4737:Cntnap2	UTSW	6	45,037,251 (GRCm39)	missense	possibly damaging	0.65
R4740:Cntnap2	UTSW	6	45,037,251 (GRCm39)	missense	possibly damaging	0.65
R4915:Cntnap2	UTSW	6	46,506,969 (GRCm39)	intron	probably benign
R4918:Cntnap2	UTSW	6	46,506,969 (GRCm39)	intron	probably benign
R4999:Cntnap2	UTSW	6	45,897,768 (GRCm39)	missense	probably damaging	0.96
R5373:Cntnap2	UTSW	6	47,084,903 (GRCm39)	missense	probably benign	0.00
R5374:Cntnap2	UTSW	6	47,084,903 (GRCm39)	missense	probably benign	0.00
R5742:Cntnap2	UTSW	6	45,897,860 (GRCm39)	nonsense	probably null
R5748:Cntnap2	UTSW	6	45,692,818 (GRCm39)	missense	probably damaging	1.00
R5765:Cntnap2	UTSW	6	46,506,749 (GRCm39)	intron	probably benign
R6181:Cntnap2	UTSW	6	46,736,742 (GRCm39)	missense	probably damaging	1.00
R6189:Cntnap2	UTSW	6	47,248,232 (GRCm39)	missense	probably damaging	1.00
R6262:Cntnap2	UTSW	6	45,037,046 (GRCm39)	splice site	probably null
R6385:Cntnap2	UTSW	6	46,833,114 (GRCm39)	missense	probably benign	0.00
R6555:Cntnap2	UTSW	6	46,736,694 (GRCm39)	missense	probably damaging	1.00
R6577:Cntnap2	UTSW	6	46,147,206 (GRCm39)	missense	probably benign	0.25
R6610:Cntnap2	UTSW	6	45,992,191 (GRCm39)	missense	probably benign	0.08
R6761:Cntnap2	UTSW	6	47,026,307 (GRCm39)	missense	probably benign	0.03
R7125:Cntnap2	UTSW	6	46,965,580 (GRCm39)	missense	probably benign	0.12
R7329:Cntnap2	UTSW	6	47,248,205 (GRCm39)	missense	possibly damaging	0.94
R7502:Cntnap2	UTSW	6	46,460,963 (GRCm39)	missense	possibly damaging	0.83
R7927:Cntnap2	UTSW	6	47,072,621 (GRCm39)	missense	possibly damaging	0.93
R8057:Cntnap2	UTSW	6	46,324,079 (GRCm39)	missense	probably damaging	0.98
R8261:Cntnap2	UTSW	6	47,072,627 (GRCm39)	missense	probably damaging	0.98
R8356:Cntnap2	UTSW	6	47,026,307 (GRCm39)	missense	probably benign	0.03
R8479:Cntnap2	UTSW	6	46,736,707 (GRCm39)	missense	probably benign	0.14
R8503:Cntnap2	UTSW	6	45,968,975 (GRCm39)	missense	probably damaging	1.00
R8698:Cntnap2	UTSW	6	47,026,156 (GRCm39)	missense	probably damaging	1.00
R8719:Cntnap2	UTSW	6	45,978,161 (GRCm39)	missense	probably damaging	1.00
R8816:Cntnap2	UTSW	6	46,833,076 (GRCm39)	missense	possibly damaging	0.72
R8987:Cntnap2	UTSW	6	46,460,983 (GRCm39)	missense	probably benign	0.01
R9000:Cntnap2	UTSW	6	46,461,139 (GRCm39)	intron	probably benign
R9209:Cntnap2	UTSW	6	47,026,183 (GRCm39)	missense	probably damaging	1.00
R9253:Cntnap2	UTSW	6	45,978,112 (GRCm39)	missense	probably benign	0.00
R9310:Cntnap2	UTSW	6	45,978,281 (GRCm39)	missense	probably damaging	1.00
R9395:Cntnap2	UTSW	6	45,978,244 (GRCm39)	missense	probably damaging	0.98
R9462:Cntnap2	UTSW	6	46,211,217 (GRCm39)	missense	probably damaging	0.99
R9526:Cntnap2	UTSW	6	45,992,165 (GRCm39)	missense	probably damaging	1.00
R9600:Cntnap2	UTSW	6	45,969,009 (GRCm39)	missense	probably damaging	0.98
R9621:Cntnap2	UTSW	6	46,965,726 (GRCm39)	missense	probably damaging	0.98
R9738:Cntnap2	UTSW	6	45,992,373 (GRCm39)	frame shift	probably null
R9745:Cntnap2	UTSW	6	46,211,100 (GRCm39)	missense	probably benign	0.01
R9775:Cntnap2	UTSW	6	47,026,261 (GRCm39)	missense	probably damaging	1.00
RF022:Cntnap2	UTSW	6	46,998,599 (GRCm39)	missense	probably damaging	1.00
X0018:Cntnap2	UTSW	6	45,986,452 (GRCm39)	missense	possibly damaging	0.53
X0063:Cntnap2	UTSW	6	46,998,688 (GRCm39)	missense	possibly damaging	0.92
X0066:Cntnap2	UTSW	6	46,211,179 (GRCm39)	missense	probably benign	0.03
Z1176:Cntnap2	UTSW	6	47,248,082 (GRCm39)	missense	probably benign	0.00
Z1177:Cntnap2	UTSW	6	45,992,233 (GRCm39)	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TCCTTTTCCTCAGGGTGGAC -3'
(R):5'- ATACTCCTGTGAGACACCGTC -3'

Sequencing Primer
(F):5'- CCTCAGGGTGGACTTTAAATCCTG -3'
(R):5'- TGTGAGACACCGTCAACAAC -3'

Posted On

2017-08-16