Incidental Mutation 'R6118:Rfx6'
ID 485215
Institutional Source Beutler Lab
Gene Symbol Rfx6
Ensembl Gene ENSMUSG00000019900
Gene Name regulatory factor X, 6
Synonyms 4930572O07Rik, Rfxdc1
MMRRC Submission 044267-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6118 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 51553856-51606525 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 51587962 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 277 (N277K)
Ref Sequence ENSEMBL: ENSMUSP00000151430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050455] [ENSMUST00000122922] [ENSMUST00000219364]
AlphaFold Q8C7R7
Predicted Effect possibly damaging
Transcript: ENSMUST00000050455
AA Change: N13K

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000057384
Gene: ENSMUSG00000019900
AA Change: N13K

DomainStartEndE-ValueType
Blast:HisKA 91 153 1e-7 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000122922
AA Change: N277K

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116057
Gene: ENSMUSG00000019900
AA Change: N277K

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 120 198 1.9e-33 PFAM
Blast:HisKA 355 417 2e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217662
Predicted Effect possibly damaging
Transcript: ENSMUST00000219364
AA Change: N277K

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect unknown
Transcript: ENSMUST00000219771
AA Change: N64K
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear protein encoded by this gene is a member of the regulatory factor X (RFX) family of transcription factors. Studies in mice suggest that this gene is specifically required for the differentiation of islet cells for the production of insulin, but not for the differentiation of pancreatic polypeptide-producing cells. It regulates the transcription factors involved in beta-cell maturation and function, thus, restricting the expression of the beta-cell differentiation and specification genes. Mutations in this gene are associated with Mitchell-Riley syndrome, which is characterized by neonatal diabetes with pancreatic hypoplasia, duodenal and jejunal atresia, and gall bladder agenesis.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes fail to feed normally, show small bowel obstruction and die within 2 days of birth. Mutants fail to generate any of the normal islet cell types except for pancreatic-polypeptide-producing cells. Some display a reduced pancreas size; however, primary cilia formation in islets is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,307,035 (GRCm39) K316N probably damaging Het
Als2 A T 1: 59,242,228 (GRCm39) V609E possibly damaging Het
Ank3 A G 10: 69,830,231 (GRCm39) I71V probably damaging Het
Antxr2 T A 5: 98,097,060 (GRCm39) D351V probably damaging Het
Arel1 A G 12: 84,988,713 (GRCm39) V12A possibly damaging Het
Atad1 C T 19: 32,664,697 (GRCm39) R239H possibly damaging Het
B3galnt2 A G 13: 14,166,094 (GRCm39) T330A probably damaging Het
Bag6 T A 17: 35,362,600 (GRCm39) I636N probably damaging Het
C1qtnf6 T C 15: 78,409,595 (GRCm39) D84G probably damaging Het
Ceacam20 T C 7: 19,705,654 (GRCm39) V215A possibly damaging Het
Chtf18 C T 17: 25,938,133 (GRCm39) D967N probably damaging Het
Cntnap2 T A 6: 47,170,011 (GRCm39) I1159K possibly damaging Het
Col2a1 T C 15: 97,896,448 (GRCm39) D67G unknown Het
Csde1 T A 3: 102,962,070 (GRCm39) V627E probably benign Het
Epb41l1 G A 2: 156,364,397 (GRCm39) E969K probably benign Het
Fam53c A C 18: 34,901,743 (GRCm39) E220A probably damaging Het
Gabbr2 C T 4: 46,736,459 (GRCm39) R474Q probably damaging Het
H2bc18 T A 3: 96,177,267 (GRCm39) V67E probably damaging Het
Hap1 G T 11: 100,246,620 (GRCm39) T95N probably benign Het
Jmjd1c A G 10: 67,075,791 (GRCm39) K1886R probably damaging Het
Kndc1 A G 7: 139,503,717 (GRCm39) D1007G probably damaging Het
Mcm2 C T 6: 88,864,818 (GRCm39) A553T probably damaging Het
Memo1 T C 17: 74,509,302 (GRCm39) Y239C possibly damaging Het
Meox2 GCACCACCACCACCACCACCA GCACCACCACCACCACCA 12: 37,159,030 (GRCm39) probably benign Het
Mptx2 G A 1: 173,102,414 (GRCm39) L92F probably benign Het
Obsl1 A G 1: 75,468,722 (GRCm39) probably benign Het
Or4c107 T A 2: 88,789,462 (GRCm39) Y217* probably null Het
Or8k35 T A 2: 86,424,758 (GRCm39) H138L probably benign Het
Pold3 A G 7: 99,745,614 (GRCm39) S180P possibly damaging Het
Rbm12b2 T C 4: 12,095,135 (GRCm39) S665P probably benign Het
Rfc4 A T 16: 22,939,693 (GRCm39) S86T probably damaging Het
Ryr2 C A 13: 11,807,575 (GRCm39) V865F possibly damaging Het
Skint4 T A 4: 111,977,019 (GRCm39) probably null Het
Slc38a10 T C 11: 120,023,669 (GRCm39) Y249C probably damaging Het
Slco1b2 A G 6: 141,603,236 (GRCm39) T206A probably benign Het
Slco3a1 C T 7: 73,968,254 (GRCm39) D489N probably benign Het
Tasor2 C T 13: 3,631,891 (GRCm39) R870H possibly damaging Het
Tbc1d1 C T 5: 64,441,380 (GRCm39) L655F probably damaging Het
Tpp2 A T 1: 43,979,306 (GRCm39) I68F probably damaging Het
Trim30c G T 7: 104,031,288 (GRCm39) T509K probably benign Het
Zfp827 G T 8: 79,803,067 (GRCm39) K546N possibly damaging Het
Other mutations in Rfx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Rfx6 APN 10 51,557,982 (GRCm39) missense probably damaging 1.00
IGL00816:Rfx6 APN 10 51,554,501 (GRCm39) missense probably benign 0.16
IGL01639:Rfx6 APN 10 51,592,002 (GRCm39) nonsense probably null
IGL01721:Rfx6 APN 10 51,599,173 (GRCm39) missense probably damaging 1.00
IGL01861:Rfx6 APN 10 51,597,675 (GRCm39) missense probably damaging 1.00
IGL02103:Rfx6 APN 10 51,602,952 (GRCm39) missense possibly damaging 0.93
IGL02113:Rfx6 APN 10 51,554,108 (GRCm39) missense probably benign
IGL02479:Rfx6 APN 10 51,554,424 (GRCm39) missense probably benign 0.07
IGL02592:Rfx6 APN 10 51,592,119 (GRCm39) missense probably damaging 1.00
IGL02635:Rfx6 APN 10 51,592,122 (GRCm39) missense possibly damaging 0.80
IGL02891:Rfx6 APN 10 51,599,942 (GRCm39) missense possibly damaging 0.64
IGL03153:Rfx6 APN 10 51,599,217 (GRCm39) nonsense probably null
IGL03263:Rfx6 APN 10 51,601,903 (GRCm39) missense probably benign 0.00
IGL03373:Rfx6 APN 10 51,596,096 (GRCm39) missense probably damaging 0.99
bulky UTSW 10 51,554,429 (GRCm39) missense probably benign 0.00
R0060:Rfx6 UTSW 10 51,553,936 (GRCm39) missense probably benign 0.00
R0433:Rfx6 UTSW 10 51,596,124 (GRCm39) missense probably damaging 1.00
R1329:Rfx6 UTSW 10 51,569,833 (GRCm39) missense probably damaging 1.00
R1709:Rfx6 UTSW 10 51,554,498 (GRCm39) missense possibly damaging 0.64
R1820:Rfx6 UTSW 10 51,599,221 (GRCm39) critical splice donor site probably null
R2017:Rfx6 UTSW 10 51,597,700 (GRCm39) missense possibly damaging 0.50
R2020:Rfx6 UTSW 10 51,596,153 (GRCm39) critical splice donor site probably null
R2044:Rfx6 UTSW 10 51,594,222 (GRCm39) missense probably benign 0.16
R2495:Rfx6 UTSW 10 51,602,771 (GRCm39) splice site probably benign
R2655:Rfx6 UTSW 10 51,569,873 (GRCm39) splice site probably benign
R2912:Rfx6 UTSW 10 51,594,226 (GRCm39) missense probably damaging 1.00
R3159:Rfx6 UTSW 10 51,602,816 (GRCm39) missense probably damaging 1.00
R4036:Rfx6 UTSW 10 51,602,842 (GRCm39) missense probably damaging 1.00
R4536:Rfx6 UTSW 10 51,599,880 (GRCm39) missense probably benign 0.16
R4791:Rfx6 UTSW 10 51,596,040 (GRCm39) splice site probably null
R4945:Rfx6 UTSW 10 51,602,947 (GRCm39) nonsense probably null
R5223:Rfx6 UTSW 10 51,554,092 (GRCm39) nonsense probably null
R5233:Rfx6 UTSW 10 51,588,187 (GRCm39) nonsense probably null
R5448:Rfx6 UTSW 10 51,559,733 (GRCm39) missense probably damaging 1.00
R5600:Rfx6 UTSW 10 51,599,157 (GRCm39) missense probably damaging 1.00
R5768:Rfx6 UTSW 10 51,602,976 (GRCm39) missense probably damaging 0.99
R5858:Rfx6 UTSW 10 51,601,964 (GRCm39) missense probably benign 0.00
R5949:Rfx6 UTSW 10 51,554,429 (GRCm39) missense probably benign 0.00
R6001:Rfx6 UTSW 10 51,594,307 (GRCm39) splice site probably null
R6003:Rfx6 UTSW 10 51,584,683 (GRCm39) missense probably damaging 1.00
R6629:Rfx6 UTSW 10 51,601,586 (GRCm39) missense probably benign 0.02
R6876:Rfx6 UTSW 10 51,596,087 (GRCm39) missense probably damaging 1.00
R6894:Rfx6 UTSW 10 51,592,135 (GRCm39) missense probably damaging 1.00
R6912:Rfx6 UTSW 10 51,599,949 (GRCm39) missense probably benign 0.00
R7130:Rfx6 UTSW 10 51,554,476 (GRCm39) nonsense probably null
R7574:Rfx6 UTSW 10 51,557,914 (GRCm39) missense probably benign 0.17
R7845:Rfx6 UTSW 10 51,554,122 (GRCm39) missense probably benign 0.05
R8188:Rfx6 UTSW 10 51,594,292 (GRCm39) missense probably benign 0.05
R8338:Rfx6 UTSW 10 51,594,190 (GRCm39) missense probably damaging 0.96
R8710:Rfx6 UTSW 10 51,601,501 (GRCm39) missense probably damaging 1.00
R8716:Rfx6 UTSW 10 51,557,968 (GRCm39) missense probably damaging 1.00
R8982:Rfx6 UTSW 10 51,599,915 (GRCm39) missense probably benign 0.14
R9104:Rfx6 UTSW 10 51,599,106 (GRCm39) missense probably damaging 1.00
R9154:Rfx6 UTSW 10 51,597,600 (GRCm39) missense probably benign 0.01
R9188:Rfx6 UTSW 10 51,594,263 (GRCm39) missense probably benign 0.04
R9388:Rfx6 UTSW 10 51,554,117 (GRCm39) missense possibly damaging 0.60
V8831:Rfx6 UTSW 10 51,594,304 (GRCm39) critical splice donor site probably null
X0023:Rfx6 UTSW 10 51,554,507 (GRCm39) missense probably damaging 1.00
Z1176:Rfx6 UTSW 10 51,601,927 (GRCm39) nonsense probably null
Z1176:Rfx6 UTSW 10 51,594,189 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CATCATAAGGTGTCCAGTCCC -3'
(R):5'- ACAGGATTTTCAAGCAGGGG -3'

Sequencing Primer
(F):5'- AGAGGCAATGATTTGACCTCC -3'
(R):5'- GAAGGAGATGGTCTGGCATTCC -3'
Posted On 2017-08-16