Incidental Mutation 'R6118:Col2a1'
ID485226
Institutional Source Beutler Lab
Gene Symbol Col2a1
Ensembl Gene ENSMUSG00000022483
Gene Namecollagen, type II, alpha 1
SynonymsM100856, Col2a, Col2a-1, Del1, Col2, Rgsc856, Lpk
MMRRC Submission 044267-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6118 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location97975602-98004695 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97998567 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 67 (D67G)
Ref Sequence ENSEMBL: ENSMUSP00000085693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023123] [ENSMUST00000088355] [ENSMUST00000131560]
Predicted Effect unknown
Transcript: ENSMUST00000023123
AA Change: D135G
SMART Domains Protein: ENSMUSP00000023123
Gene: ENSMUSG00000022483
AA Change: D135G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWC 34 88 1.59e-21 SMART
Pfam:Collagen 115 175 1.3e-11 PFAM
Pfam:Collagen 199 260 7.2e-11 PFAM
Pfam:Collagen 258 317 1.3e-12 PFAM
Pfam:Collagen 312 377 4e-9 PFAM
low complexity region 395 411 N/A INTRINSIC
low complexity region 416 451 N/A INTRINSIC
internal_repeat_5 456 468 5.45e-5 PROSPERO
low complexity region 471 513 N/A INTRINSIC
internal_repeat_3 516 619 3.99e-13 PROSPERO
internal_repeat_1 524 567 1.6e-17 PROSPERO
low complexity region 621 633 N/A INTRINSIC
low complexity region 636 655 N/A INTRINSIC
low complexity region 659 687 N/A INTRINSIC
low complexity region 696 753 N/A INTRINSIC
internal_repeat_5 756 768 5.45e-5 PROSPERO
low complexity region 783 804 N/A INTRINSIC
Pfam:Collagen 852 918 1.1e-8 PFAM
Pfam:Collagen 876 941 1.9e-9 PFAM
Pfam:Collagen 900 966 2.4e-9 PFAM
Pfam:Collagen 983 1049 2.1e-10 PFAM
low complexity region 1062 1081 N/A INTRINSIC
Pfam:Collagen 1101 1172 3.4e-9 PFAM
Pfam:Collagen 1158 1218 1.3e-9 PFAM
COLFI 1252 1487 3.06e-184 SMART
Predicted Effect unknown
Transcript: ENSMUST00000088355
AA Change: D67G
SMART Domains Protein: ENSMUSP00000085693
Gene: ENSMUSG00000022483
AA Change: D67G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Collagen 47 107 1.2e-11 PFAM
Pfam:Collagen 131 192 7.2e-11 PFAM
Pfam:Collagen 190 249 1.3e-12 PFAM
low complexity region 262 314 N/A INTRINSIC
Pfam:Collagen 327 405 3.5e-7 PFAM
Pfam:Collagen 361 429 7.6e-10 PFAM
internal_repeat_3 448 551 1.3e-13 PROSPERO
internal_repeat_7 454 466 2.86e-5 PROSPERO
internal_repeat_1 456 499 4.05e-18 PROSPERO
internal_repeat_6 481 504 1.7e-5 PROSPERO
low complexity region 553 565 N/A INTRINSIC
low complexity region 568 587 N/A INTRINSIC
low complexity region 591 619 N/A INTRINSIC
low complexity region 628 685 N/A INTRINSIC
internal_repeat_4 688 712 8.3e-12 PROSPERO
low complexity region 715 736 N/A INTRINSIC
low complexity region 747 784 N/A INTRINSIC
Pfam:Collagen 808 878 9.8e-9 PFAM
Pfam:Collagen 832 898 2.1e-9 PFAM
Pfam:Collagen 916 979 7.2e-10 PFAM
Pfam:Collagen 937 1005 2.1e-8 PFAM
Pfam:Collagen 973 1049 6e-7 PFAM
Pfam:Collagen 1030 1094 1.5e-10 PFAM
Pfam:Collagen 1088 1150 1.4e-9 PFAM
COLFI 1184 1419 3.06e-184 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131560
SMART Domains Protein: ENSMUSP00000116951
Gene: ENSMUSG00000022483

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWC 34 88 1.59e-21 SMART
low complexity region 109 132 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140064
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230148
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of the fibril-forming type II collagen, the major component of cartilage and the vitreous humor of the eye. The encoded preproprotein forms homotrimeric, triple helical procollagen that undergoes proteolytic processing during fibirl formation. Mice harboring certain mutations in this gene exhibit severe chondrodysplasia characterized by short limbs and trunch, craniofacial deformities and cleft palate. A complete lack of the encoded protein in mice results in postnatal lethality. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mutations in this locus affect cartilage development. Homozygotes die perinatally with anomalies such as shortened limbs without epiphiseal growth plates, cleft palate and persistence of notochord. Heterozygotes are dwarfed with reduced cartilage matrix. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,431,291 K316N probably damaging Het
Als2 A T 1: 59,203,069 V609E possibly damaging Het
Ank3 A G 10: 69,994,401 I71V probably damaging Het
Antxr2 T A 5: 97,949,201 D351V probably damaging Het
Arel1 A G 12: 84,941,939 V12A possibly damaging Het
Atad1 C T 19: 32,687,297 R239H possibly damaging Het
B3galnt2 A G 13: 13,991,509 T330A probably damaging Het
Bag6 T A 17: 35,143,624 I636N probably damaging Het
C1qtnf6 T C 15: 78,525,395 D84G probably damaging Het
Ceacam20 T C 7: 19,971,729 V215A possibly damaging Het
Chtf18 C T 17: 25,719,159 D967N probably damaging Het
Cntnap2 T A 6: 47,193,077 I1159K possibly damaging Het
Csde1 T A 3: 103,054,754 V627E probably benign Het
Epb41l1 G A 2: 156,522,477 E969K probably benign Het
Fam208b C T 13: 3,581,891 R870H possibly damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gabbr2 C T 4: 46,736,459 R474Q probably damaging Het
Hap1 G T 11: 100,355,794 T95N probably benign Het
Hist2h2bb T A 3: 96,269,951 V67E probably damaging Het
Jmjd1c A G 10: 67,240,012 K1886R probably damaging Het
Kndc1 A G 7: 139,923,802 D1007G probably damaging Het
Mcm2 C T 6: 88,887,836 A553T probably damaging Het
Memo1 T C 17: 74,202,307 Y239C possibly damaging Het
Meox2 GCACCACCACCACCACCACCA GCACCACCACCACCACCA 12: 37,109,031 probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Obsl1 A G 1: 75,492,078 probably benign Het
Olfr1082 T A 2: 86,594,414 H138L probably benign Het
Olfr1212 T A 2: 88,959,118 Y217* probably null Het
Pold3 A G 7: 100,096,407 S180P possibly damaging Het
Rbm12b2 T C 4: 12,095,135 S665P probably benign Het
Rfc4 A T 16: 23,120,943 S86T probably damaging Het
Rfx6 T A 10: 51,711,866 N277K possibly damaging Het
Ryr2 C A 13: 11,792,689 V865F possibly damaging Het
Skint4 T A 4: 112,119,822 probably null Het
Slc38a10 T C 11: 120,132,843 Y249C probably damaging Het
Slco1b2 A G 6: 141,657,510 T206A probably benign Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Tbc1d1 C T 5: 64,284,037 L655F probably damaging Het
Tpp2 A T 1: 43,940,146 I68F probably damaging Het
Trim30c G T 7: 104,382,081 T509K probably benign Het
Zfp827 G T 8: 79,076,438 K546N possibly damaging Het
Other mutations in Col2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Col2a1 APN 15 97976173 missense unknown
IGL01286:Col2a1 APN 15 97994878 missense unknown
IGL01369:Col2a1 APN 15 97977826 missense unknown
IGL01747:Col2a1 APN 15 97991392 splice site probably benign
IGL02086:Col2a1 APN 15 97986737 splice site probably null
IGL02549:Col2a1 APN 15 97977799 missense unknown
IGL03289:Col2a1 APN 15 97980881 missense unknown
IGL03369:Col2a1 APN 15 97982042 missense unknown
FR4304:Col2a1 UTSW 15 97988981 synonymous probably null
FR4340:Col2a1 UTSW 15 97988981 synonymous probably null
FR4342:Col2a1 UTSW 15 97988981 synonymous probably null
FR4589:Col2a1 UTSW 15 97988981 synonymous probably null
LCD18:Col2a1 UTSW 15 97988981 synonymous probably null
R0124:Col2a1 UTSW 15 97998862 missense unknown
R0227:Col2a1 UTSW 15 97976755 missense unknown
R0690:Col2a1 UTSW 15 97980192 missense unknown
R1434:Col2a1 UTSW 15 97979651 missense probably damaging 0.96
R1473:Col2a1 UTSW 15 97982908 splice site probably benign
R1577:Col2a1 UTSW 15 97979202 missense probably damaging 1.00
R1598:Col2a1 UTSW 15 97979250 missense probably damaging 0.99
R1837:Col2a1 UTSW 15 97996641 splice site probably benign
R2153:Col2a1 UTSW 15 97987580 missense unknown
R2965:Col2a1 UTSW 15 97976095 missense unknown
R2966:Col2a1 UTSW 15 97976095 missense unknown
R3710:Col2a1 UTSW 15 97990907 splice site probably benign
R3838:Col2a1 UTSW 15 97988976 missense unknown
R3838:Col2a1 UTSW 15 98000581 intron probably benign
R4112:Col2a1 UTSW 15 97983701 missense probably benign 0.18
R4417:Col2a1 UTSW 15 97998585 missense unknown
R4656:Col2a1 UTSW 15 97976176 missense unknown
R4960:Col2a1 UTSW 15 97976149 missense unknown
R5008:Col2a1 UTSW 15 97979669 missense probably benign 0.28
R5435:Col2a1 UTSW 15 98000510 intron probably benign
R5473:Col2a1 UTSW 15 97987489 missense unknown
R6042:Col2a1 UTSW 15 98000570 intron probably benign
R6183:Col2a1 UTSW 15 97988790 missense unknown
R6187:Col2a1 UTSW 15 97988790 missense unknown
R6401:Col2a1 UTSW 15 97985892 missense unknown
R6550:Col2a1 UTSW 15 97976793 missense unknown
R6568:Col2a1 UTSW 15 97977276 missense unknown
R6988:Col2a1 UTSW 15 98004454 missense unknown
R7060:Col2a1 UTSW 15 97976141 missense unknown
R7069:Col2a1 UTSW 15 97998588 missense unknown
R7167:Col2a1 UTSW 15 98000456 missense unknown
R7392:Col2a1 UTSW 15 97980151 nonsense probably null
R7491:Col2a1 UTSW 15 97976159 missense not run
Predicted Primers PCR Primer
(F):5'- GGTACCAGGTTCTCCATCTCTG -3'
(R):5'- TGCACCCCTCTAACCAATGG -3'

Sequencing Primer
(F):5'- TCCATCTCTGCCACGGG -3'
(R):5'- TCTAACCAATGGGCTCATGG -3'
Posted On2017-08-16