Incidental Mutation 'R6101:Tnfsf10'
ID 485238
Institutional Source Beutler Lab
Gene Symbol Tnfsf10
Ensembl Gene ENSMUSG00000039304
Gene Name tumor necrosis factor (ligand) superfamily, member 10
Synonyms APO-2L, A330042I21Rik, Trail
MMRRC Submission 044251-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6101 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 27371226-27393814 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 27389698 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 253 (Y253C)
Ref Sequence ENSEMBL: ENSMUSP00000040271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046383] [ENSMUST00000174840]
AlphaFold P50592
Predicted Effect probably damaging
Transcript: ENSMUST00000046383
AA Change: Y253C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040271
Gene: ENSMUSG00000039304
AA Change: Y253C

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
TNF 146 290 5.35e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174840
SMART Domains Protein: ENSMUSP00000133917
Gene: ENSMUSG00000039304

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:TNF 156 226 7.1e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This protein preferentially induces apoptosis in transformed and tumor cells, but does not appear to kill normal cells although it is expressed at a significant level in most normal tissues. This protein binds to several members of TNF receptor superfamily including TNFRSF10A/TRAILR1, TNFRSF10B/TRAILR2, TNFRSF10C/TRAILR3, TNFRSF10D/TRAILR4, and possibly also to TNFRSF11B/OPG. The activity of this protein may be modulated by binding to the decoy receptors TNFRSF10C/TRAILR3, TNFRSF10D/TRAILR4, and TNFRSF11B/OPG that cannot induce apoptosis. The binding of this protein to its receptors has been shown to trigger the activation of MAPK8/JNK, caspase 8, and caspase 3. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygotes for a null allele show thymus hyperplasia, abnormal negative T cell selection, increased susceptibility to autoimmune diseases and to tumor initiation and metastasis, and resistance to induced hepatitis. Homozygotes for another null allele are unable to control A20 lymphoma progression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 25,460,775 (GRCm39) C570S probably damaging Het
Adh6b T A 3: 138,063,471 (GRCm39) I350K possibly damaging Het
Ahnak G A 19: 8,981,463 (GRCm39) V916I probably benign Het
Aldh4a1 C T 4: 139,365,806 (GRCm39) P266S possibly damaging Het
Arhgap11a G A 2: 113,665,219 (GRCm39) R460* probably null Het
Chl1 A T 6: 103,669,993 (GRCm39) D477V probably damaging Het
Clstn3 A T 6: 124,438,629 (GRCm39) L45Q probably damaging Het
Cnot7 C T 8: 40,963,078 (GRCm39) R32Q probably benign Het
Csrnp1 T C 9: 119,802,551 (GRCm39) D220G probably damaging Het
Cyb5a G A 18: 84,889,718 (GRCm39) R49Q possibly damaging Het
Fblim1 G A 4: 141,312,033 (GRCm39) R231C probably damaging Het
Glul T A 1: 153,782,177 (GRCm39) Y137* probably null Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Igha T A 12: 113,220,017 (GRCm39) probably benign Het
Kif2b A G 11: 91,466,814 (GRCm39) S490P probably benign Het
Kxd1 A T 8: 70,972,589 (GRCm39) N33K probably benign Het
Lrrk2 T C 15: 91,607,338 (GRCm39) I567T probably benign Het
Man2a2 T C 7: 80,016,749 (GRCm39) D355G probably damaging Het
Map6 T C 7: 98,917,314 (GRCm39) V29A probably damaging Het
Mical3 A T 6: 121,010,671 (GRCm39) V437D probably damaging Het
Mief1 T C 15: 80,133,941 (GRCm39) Y333H probably benign Het
Or12j4 T A 7: 140,046,432 (GRCm39) V106D probably benign Het
Or4f7 A G 2: 111,644,598 (GRCm39) F158L probably benign Het
Or8b52 A G 9: 38,576,916 (GRCm39) S75P probably damaging Het
Or8d2b T C 9: 38,788,604 (GRCm39) L44P possibly damaging Het
Pak1ip1 T A 13: 41,158,361 (GRCm39) L78Q probably damaging Het
Pikfyve A G 1: 65,303,504 (GRCm39) probably null Het
Pinlyp C T 7: 24,245,405 (GRCm39) R5K possibly damaging Het
Pkd1l3 A G 8: 110,367,478 (GRCm39) D1225G probably damaging Het
Pnma8b T A 7: 16,680,493 (GRCm39) S492R probably benign Het
Postn A G 3: 54,279,641 (GRCm39) probably null Het
Ptprq A G 10: 107,416,127 (GRCm39) Y1724H possibly damaging Het
Rpn2 T A 2: 157,152,108 (GRCm39) probably null Het
Scn5a A G 9: 119,351,716 (GRCm39) V755A probably damaging Het
Slc22a30 T C 19: 8,315,232 (GRCm39) probably null Het
Specc1l T C 10: 75,084,466 (GRCm39) S730P probably damaging Het
Steap2 T A 5: 5,725,891 (GRCm39) I378F possibly damaging Het
Tdrd12 A T 7: 35,180,558 (GRCm39) Y818* probably null Het
Thbs4 G T 13: 92,911,993 (GRCm39) Q246K possibly damaging Het
Tnpo3 G T 6: 29,588,042 (GRCm39) C125* probably null Het
Trim58 A G 11: 58,542,441 (GRCm39) N467S probably benign Het
Trpm6 C T 19: 18,831,112 (GRCm39) R1326* probably null Het
Zc3hav1l A G 6: 38,270,012 (GRCm39) V279A probably benign Het
Zfp618 A T 4: 63,051,478 (GRCm39) Q753L probably benign Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Zkscan17 A T 11: 59,394,401 (GRCm39) C67S probably damaging Het
Other mutations in Tnfsf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02155:Tnfsf10 APN 3 27,389,380 (GRCm39) missense possibly damaging 0.71
IGL03071:Tnfsf10 APN 3 27,389,769 (GRCm39) missense probably damaging 1.00
IGL03157:Tnfsf10 APN 3 27,380,106 (GRCm39) missense possibly damaging 0.77
IGL03226:Tnfsf10 APN 3 27,389,597 (GRCm39) nonsense probably null
R4051:Tnfsf10 UTSW 3 27,389,503 (GRCm39) missense probably damaging 1.00
R4679:Tnfsf10 UTSW 3 27,389,728 (GRCm39) missense probably damaging 0.99
R5799:Tnfsf10 UTSW 3 27,389,742 (GRCm39) missense probably damaging 1.00
R6105:Tnfsf10 UTSW 3 27,389,698 (GRCm39) missense probably damaging 1.00
R6882:Tnfsf10 UTSW 3 27,380,182 (GRCm39) missense possibly damaging 0.95
R7362:Tnfsf10 UTSW 3 27,389,497 (GRCm39) missense probably damaging 1.00
R7873:Tnfsf10 UTSW 3 27,389,808 (GRCm39) missense probably benign 0.05
R8819:Tnfsf10 UTSW 3 27,389,451 (GRCm39) missense probably benign 0.07
R9034:Tnfsf10 UTSW 3 27,389,379 (GRCm39) missense probably benign 0.00
R9035:Tnfsf10 UTSW 3 27,389,379 (GRCm39) missense probably benign 0.00
R9125:Tnfsf10 UTSW 3 27,380,028 (GRCm39) intron probably benign
R9193:Tnfsf10 UTSW 3 27,371,407 (GRCm39) missense possibly damaging 0.90
R9334:Tnfsf10 UTSW 3 27,389,496 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAAGCTGAAGACGCTTC -3'
(R):5'- TGAGGTTTCTACAGCCAGGC -3'

Sequencing Primer
(F):5'- TGAAGACGCTTCCAAGATGGTCTC -3'
(R):5'- GAGGTTTCTACAGCCAGGCCATATC -3'
Posted On 2017-08-16