Incidental Mutation 'R6101:Gm10549'
ID485276
Institutional Source Beutler Lab
Gene Symbol Gm10549
Ensembl Gene ENSMUSG00000073610
Gene Namepredicted gene 10549
Synonyms
MMRRC Submission 044251-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6101 (G1)
Quality Score127.008
Status Not validated
Chromosome18
Chromosomal Location33464163-33472448 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 33464305 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051087] [ENSMUST00000097634] [ENSMUST00000168890] [ENSMUST00000171533]
Predicted Effect probably benign
Transcript: ENSMUST00000051087
SMART Domains Protein: ENSMUSP00000058132
Gene: ENSMUSG00000042834

DomainStartEndE-ValueType
Pfam:Alveol-reg_P311 1 68 2.6e-41 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000097634
AA Change: A48D
SMART Domains Protein: ENSMUSP00000095236
Gene: ENSMUSG00000073610
AA Change: A48D

DomainStartEndE-ValueType
low complexity region 56 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168890
SMART Domains Protein: ENSMUSP00000130297
Gene: ENSMUSG00000042834

DomainStartEndE-ValueType
Pfam:Alveol-reg_P311 1 68 2.6e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171533
SMART Domains Protein: ENSMUSP00000127787
Gene: ENSMUSG00000042834

DomainStartEndE-ValueType
Pfam:Alveol-reg_P311 1 68 2.6e-41 PFAM
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 24,970,759 C570S probably damaging Het
Adh6b T A 3: 138,357,710 I350K possibly damaging Het
Ahnak G A 19: 9,004,099 V916I probably benign Het
Aldh4a1 C T 4: 139,638,495 P266S possibly damaging Het
Arhgap11a G A 2: 113,834,874 R460* probably null Het
Chl1 A T 6: 103,693,032 D477V probably damaging Het
Clstn3 A T 6: 124,461,670 L45Q probably damaging Het
Cnot7 C T 8: 40,510,037 R32Q probably benign Het
Csrnp1 T C 9: 119,973,485 D220G probably damaging Het
Cyb5a G A 18: 84,871,593 R49Q possibly damaging Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Glul T A 1: 153,906,431 Y137* probably null Het
Igha T A 12: 113,256,397 probably benign Het
Kif2b A G 11: 91,575,988 S490P probably benign Het
Kxd1 A T 8: 70,519,939 N33K probably benign Het
Lrrk2 T C 15: 91,723,135 I567T probably benign Het
Man2a2 T C 7: 80,367,001 D355G probably damaging Het
Map6 T C 7: 99,268,107 V29A probably damaging Het
Mical3 A T 6: 121,033,710 V437D probably damaging Het
Mief1 T C 15: 80,249,740 Y333H probably benign Het
Olfr1303 A G 2: 111,814,253 F158L probably benign Het
Olfr533 T A 7: 140,466,519 V106D probably benign Het
Olfr917 A G 9: 38,665,620 S75P probably damaging Het
Olfr926 T C 9: 38,877,308 L44P possibly damaging Het
Pak1ip1 T A 13: 41,004,885 L78Q probably damaging Het
Pikfyve A G 1: 65,264,345 probably null Het
Pinlyp C T 7: 24,545,980 R5K possibly damaging Het
Pkd1l3 A G 8: 109,640,846 D1225G probably damaging Het
Pnmal2 T A 7: 16,946,568 S492R probably benign Het
Postn A G 3: 54,372,220 probably null Het
Ptprq A G 10: 107,580,266 Y1724H possibly damaging Het
Rpn2 T A 2: 157,310,188 probably null Het
Scn5a A G 9: 119,522,650 V755A probably damaging Het
Slc22a30 T C 19: 8,337,868 probably null Het
Specc1l T C 10: 75,248,632 S730P probably damaging Het
Steap2 T A 5: 5,675,891 I378F possibly damaging Het
Tdrd12 A T 7: 35,481,133 Y818* probably null Het
Thbs4 G T 13: 92,775,485 Q246K possibly damaging Het
Tnfsf10 A G 3: 27,335,549 Y253C probably damaging Het
Tnpo3 G T 6: 29,588,043 C125* probably null Het
Trim58 A G 11: 58,651,615 N467S probably benign Het
Trpm6 C T 19: 18,853,748 R1326* probably null Het
Zc3hav1l A G 6: 38,293,077 V279A probably benign Het
Zfp618 A T 4: 63,133,241 Q753L probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zkscan17 A T 11: 59,503,575 C67S probably damaging Het
Other mutations in Gm10549
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02648:Gm10549 APN 18 33464250 unclassified probably benign
R0374:Gm10549 UTSW 18 33464182 unclassified probably benign
R0668:Gm10549 UTSW 18 33470850 missense unknown
R1806:Gm10549 UTSW 18 33470788 missense unknown
R4214:Gm10549 UTSW 18 33464477 splice site probably null
R4826:Gm10549 UTSW 18 33470785 missense unknown
R5747:Gm10549 UTSW 18 33464305 unclassified probably benign
R5748:Gm10549 UTSW 18 33464305 unclassified probably benign
R5766:Gm10549 UTSW 18 33464305 unclassified probably benign
R5796:Gm10549 UTSW 18 33464305 unclassified probably benign
R6129:Gm10549 UTSW 18 33464305 unclassified probably benign
R6130:Gm10549 UTSW 18 33464305 unclassified probably benign
R6218:Gm10549 UTSW 18 33464305 unclassified probably benign
R6219:Gm10549 UTSW 18 33464305 unclassified probably benign
R6220:Gm10549 UTSW 18 33464305 unclassified probably benign
R6283:Gm10549 UTSW 18 33464305 unclassified probably benign
R6298:Gm10549 UTSW 18 33464305 unclassified probably benign
R6299:Gm10549 UTSW 18 33464305 unclassified probably benign
R6309:Gm10549 UTSW 18 33464305 unclassified probably benign
R6321:Gm10549 UTSW 18 33464305 unclassified probably benign
R6322:Gm10549 UTSW 18 33464305 unclassified probably benign
R6327:Gm10549 UTSW 18 33464305 unclassified probably benign
R6337:Gm10549 UTSW 18 33464305 unclassified probably benign
R6405:Gm10549 UTSW 18 33464305 unclassified probably benign
R6420:Gm10549 UTSW 18 33464305 unclassified probably benign
R6492:Gm10549 UTSW 18 33464305 unclassified probably benign
R6494:Gm10549 UTSW 18 33464305 unclassified probably benign
R6505:Gm10549 UTSW 18 33464305 unclassified probably benign
R7173:Gm10549 UTSW 18 33464409 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTAATAATAAACCTGCGGCCG -3'
(R):5'- GGGCTGAGAACTTTGAAAGC -3'

Sequencing Primer
(F):5'- CGGGGCATCTGAGGGAAC -3'
(R):5'- TAGCGTCTCCGGTTGCAC -3'
Posted On2017-08-16