Incidental Mutation 'R6102:Exoc1'
ID485297
Institutional Source Beutler Lab
Gene Symbol Exoc1
Ensembl Gene ENSMUSG00000036435
Gene Nameexocyst complex component 1
Synonyms2810407P21Rik, Sec3p, SEC3, A730011E05Rik, Sec3l1
MMRRC Submission 044252-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6102 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location76529311-76570294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76537779 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 113 (S113P)
Ref Sequence ENSEMBL: ENSMUSP00000084373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049469] [ENSMUST00000087133] [ENSMUST00000113493]
Predicted Effect probably damaging
Transcript: ENSMUST00000049469
AA Change: S113P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000046719
Gene: ENSMUSG00000036435
AA Change: S113P

DomainStartEndE-ValueType
Sec3-PIP2_bind 31 122 9.51e-41 SMART
Pfam:Sec3_C 169 856 5.5e-221 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000087133
AA Change: S113P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084373
Gene: ENSMUSG00000036435
AA Change: S113P

DomainStartEndE-ValueType
Sec3-PIP2_bind 31 122 9.51e-41 SMART
Pfam:Sec3_C 169 871 2e-220 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113493
AA Change: S113P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109121
Gene: ENSMUSG00000036435
AA Change: S113P

DomainStartEndE-ValueType
Sec3-PIP2_bind 31 122 9.51e-41 SMART
coiled coil region 161 183 N/A INTRINSIC
Pfam:Sec3_C 190 878 4.1e-186 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150829
Meta Mutation Damage Score 0.404 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e A G 11: 70,320,023 I290T possibly damaging Het
Apeh T A 9: 108,086,439 D559V probably damaging Het
Aspm T A 1: 139,477,459 Y1361* probably null Het
Atad5 G T 11: 80,111,572 probably null Het
Ccr4 C T 9: 114,496,493 probably null Het
Clasrp G A 7: 19,586,468 probably benign Het
Cldn23 A G 8: 35,825,551 M261T probably benign Het
Cmya5 T C 13: 93,094,231 M1450V probably benign Het
Cyp4v3 T A 8: 45,320,160 E202V probably damaging Het
Dnah7a A T 1: 53,559,140 V1412E probably benign Het
Dnah9 A G 11: 65,990,516 S2578P probably damaging Het
Dsc2 T A 18: 20,047,108 Y196F probably benign Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Frs3 C T 17: 47,702,671 H173Y probably damaging Het
Ginm1 G T 10: 7,768,496 T323K probably benign Het
Golgb1 T C 16: 36,912,865 S825P probably damaging Het
Hs3st3b1 A T 11: 63,921,855 C11* probably null Het
Ighv3-3 G C 12: 114,196,460 A110G possibly damaging Het
Igkv6-20 G A 6: 70,335,869 H107Y probably benign Het
Kcnj16 A G 11: 111,025,577 E355G probably benign Het
Lig4 C T 8: 9,972,872 G303S probably damaging Het
Map1b A C 13: 99,425,873 V2443G unknown Het
Map3k6 T C 4: 133,247,131 probably null Het
Mmp13 A G 9: 7,276,688 Q261R probably benign Het
Mphosph9 T A 5: 124,297,709 I554F possibly damaging Het
Mrgpra3 A T 7: 47,590,149 F10I possibly damaging Het
Ms4a18 G A 19: 11,013,523 T69I probably benign Het
Mtmr3 T C 11: 4,487,673 N927S probably damaging Het
Necab1 T A 4: 14,989,211 Q188L probably benign Het
Nfatc2 A G 2: 168,519,507 probably benign Het
Olfr152 T C 2: 87,782,848 F103L probably damaging Het
Olfr495 T C 7: 108,395,284 S55P probably damaging Het
Olfr854 T C 9: 19,567,022 M121V possibly damaging Het
Paip2b A C 6: 83,808,846 V134G possibly damaging Het
Pax3 T C 1: 78,132,347 T225A probably damaging Het
Pbx1 C A 1: 168,183,565 A298S probably benign Het
Pcdhac2 A T 18: 37,146,282 K772* probably null Het
Pcsk4 A T 10: 80,325,817 Y163* probably null Het
Plcd3 A G 11: 103,080,644 V58A probably damaging Het
Plek2 T A 12: 78,900,093 T57S possibly damaging Het
Plscr2 C T 9: 92,287,668 T57I probably benign Het
Ppp2r5b A G 19: 6,234,738 S32P probably benign Het
Ppp3r2 C T 4: 49,682,022 probably benign Het
Psme4 T A 11: 30,865,567 L1693H probably damaging Het
Rrbp1 T A 2: 143,988,393 Q618L probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Serpina3b A T 12: 104,134,169 T337S probably benign Het
Slc18a2 T C 19: 59,293,878 Y506H probably benign Het
Slc9a9 A G 9: 94,936,429 Y292C probably benign Het
Spta1 T C 1: 174,224,520 V1840A probably benign Het
Ssb T C 2: 69,871,208 *416Q probably null Het
Strada A G 11: 106,168,436 V209A probably benign Het
Tbc1d31 A T 15: 57,936,093 D225V probably damaging Het
Tgm4 T C 9: 123,056,535 F381L probably benign Het
Tmem120b T A 5: 123,115,144 Y203N probably damaging Het
Tmem176b A G 6: 48,835,934 V109A probably benign Het
Tnfrsf11a C A 1: 105,819,946 L201M possibly damaging Het
Ttn C A 2: 76,974,350 probably null Het
Tubb2a T C 13: 34,075,343 I155V probably benign Het
Vmn1r5 A G 6: 56,986,114 D258G probably damaging Het
Vmn2r121 T C X: 124,133,575 T120A probably benign Het
Vmn2r19 A T 6: 123,329,948 I472F probably damaging Het
Vwa3a A G 7: 120,776,138 probably null Het
Zfp273 A G 13: 67,822,347 Y5C probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp825 A G 13: 74,480,653 L248P probably damaging Het
Other mutations in Exoc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Exoc1 APN 5 76567023 missense possibly damaging 0.88
IGL01149:Exoc1 APN 5 76542244 splice site probably benign
IGL02061:Exoc1 APN 5 76542120 missense probably damaging 0.96
IGL02288:Exoc1 APN 5 76545313 missense probably benign
IGL02407:Exoc1 APN 5 76545346 missense probably damaging 0.97
IGL03089:Exoc1 APN 5 76542158 missense possibly damaging 0.81
IGL03242:Exoc1 APN 5 76559007 missense probably damaging 1.00
IGL03348:Exoc1 APN 5 76535593 missense probably damaging 1.00
IGL03411:Exoc1 APN 5 76542195 missense probably damaging 1.00
Smalls UTSW 5 76537779 missense probably damaging 1.00
R0462:Exoc1 UTSW 5 76543617 missense probably benign 0.37
R1216:Exoc1 UTSW 5 76554188 missense probably benign
R1528:Exoc1 UTSW 5 76549564 missense possibly damaging 0.94
R1531:Exoc1 UTSW 5 76559164 missense probably damaging 0.98
R1636:Exoc1 UTSW 5 76568118 missense probably benign 0.03
R1754:Exoc1 UTSW 5 76560322 unclassified probably null
R1803:Exoc1 UTSW 5 76561441 missense probably benign 0.18
R2086:Exoc1 UTSW 5 76532846 nonsense probably null
R2239:Exoc1 UTSW 5 76559710 unclassified probably benign
R3914:Exoc1 UTSW 5 76543561 missense possibly damaging 0.54
R4022:Exoc1 UTSW 5 76549570 missense possibly damaging 0.92
R4329:Exoc1 UTSW 5 76567975 missense probably damaging 1.00
R4413:Exoc1 UTSW 5 76542019 intron probably benign
R4427:Exoc1 UTSW 5 76563263 missense probably benign 0.00
R4557:Exoc1 UTSW 5 76561443 missense probably damaging 1.00
R4627:Exoc1 UTSW 5 76542228 missense probably benign 0.26
R4677:Exoc1 UTSW 5 76559163 missense probably null 0.82
R5138:Exoc1 UTSW 5 76568075 missense probably damaging 1.00
R5325:Exoc1 UTSW 5 76537702 missense probably benign
R5342:Exoc1 UTSW 5 76567014 missense probably damaging 1.00
R5736:Exoc1 UTSW 5 76537768 missense possibly damaging 0.90
R5891:Exoc1 UTSW 5 76542144 missense probably damaging 1.00
R6447:Exoc1 UTSW 5 76543517 missense probably damaging 0.97
R6532:Exoc1 UTSW 5 76537837 missense probably damaging 0.99
R6694:Exoc1 UTSW 5 76549552 missense probably damaging 1.00
R6753:Exoc1 UTSW 5 76563339 missense probably damaging 1.00
R6885:Exoc1 UTSW 5 76559042 missense probably damaging 1.00
R7090:Exoc1 UTSW 5 76566953 missense unknown
R7299:Exoc1 UTSW 5 76542159 missense probably damaging 1.00
R7439:Exoc1 UTSW 5 76545348 missense probably benign 0.18
R7567:Exoc1 UTSW 5 76537715 missense probably damaging 0.96
X0018:Exoc1 UTSW 5 76567035 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCTAGCCACTTACATGATATCTAATG -3'
(R):5'- TGACATATGGAGAGGCAAACTC -3'

Sequencing Primer
(F):5'- AGGACAGCTTCCATTCTC -3'
(R):5'- GAGGCAAACTCAGTATCCTAGTTAC -3'
Posted On2017-08-16